Incidental Mutation 'R5698:Eno4'
ID450824
Institutional Source Beutler Lab
Gene Symbol Eno4
Ensembl Gene ENSMUSG00000048029
Gene Nameenolase 4
Synonyms6430537H07Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5698 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location58943425-58971421 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 58968472 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047511] [ENSMUST00000054280] [ENSMUST00000163821] [ENSMUST00000200910] [ENSMUST00000200910] [ENSMUST00000202382] [ENSMUST00000202382]
Predicted Effect probably benign
Transcript: ENSMUST00000047511
SMART Domains Protein: ENSMUSP00000041378
Gene: ENSMUSG00000041362

DomainStartEndE-ValueType
coiled coil region 7 59 N/A INTRINSIC
low complexity region 120 132 N/A INTRINSIC
coiled coil region 137 233 N/A INTRINSIC
coiled coil region 259 353 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000054280
SMART Domains Protein: ENSMUSP00000062584
Gene: ENSMUSG00000048029

DomainStartEndE-ValueType
Blast:Enolase_C 29 55 6e-8 BLAST
Enolase_N 69 264 1.06e-20 SMART
Enolase_C 276 585 7.85e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163821
SMART Domains Protein: ENSMUSP00000126227
Gene: ENSMUSG00000041362

DomainStartEndE-ValueType
internal_repeat_1 59 77 1.42e-6 PROSPERO
low complexity region 120 132 N/A INTRINSIC
internal_repeat_1 207 225 1.42e-6 PROSPERO
coiled coil region 259 353 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000200910
SMART Domains Protein: ENSMUSP00000144272
Gene: ENSMUSG00000048029

DomainStartEndE-ValueType
Blast:Enolase_C 29 55 6e-8 BLAST
Enolase_N 68 263 1.06e-20 SMART
Enolase_C 275 584 7.85e-42 SMART
Predicted Effect probably null
Transcript: ENSMUST00000200910
SMART Domains Protein: ENSMUSP00000144272
Gene: ENSMUSG00000048029

DomainStartEndE-ValueType
Blast:Enolase_C 29 55 6e-8 BLAST
Enolase_N 68 263 1.06e-20 SMART
Enolase_C 275 584 7.85e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201123
Predicted Effect probably null
Transcript: ENSMUST00000202382
SMART Domains Protein: ENSMUSP00000144656
Gene: ENSMUSG00000048029

DomainStartEndE-ValueType
Blast:Enolase_N 1 88 1e-22 BLAST
Enolase_C 100 409 2.1e-45 SMART
Predicted Effect probably null
Transcript: ENSMUST00000202382
SMART Domains Protein: ENSMUSP00000144656
Gene: ENSMUSG00000048029

DomainStartEndE-ValueType
Blast:Enolase_N 1 88 1e-22 BLAST
Enolase_C 100 409 2.1e-45 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit male infertility associated with abnormal sperm morphology, number and motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik A G 11: 3,976,366 K334E possibly damaging Het
Ache G A 5: 137,290,559 V176M probably damaging Het
Acss3 T C 10: 106,948,744 D539G probably damaging Het
Adam6b T A 12: 113,491,463 D633E probably benign Het
Aldh16a1 G A 7: 45,154,407 probably benign Het
Amigo2 G A 15: 97,245,726 Q272* probably null Het
Appbp2 A T 11: 85,210,099 H171Q probably damaging Het
Arhgef18 A G 8: 3,439,499 D277G probably damaging Het
Armc8 A G 9: 99,535,820 V95A probably benign Het
Atp6v0a4 C T 6: 38,050,507 probably null Het
Atp8a1 A T 5: 67,767,153 N289K probably benign Het
Cand2 C T 6: 115,791,743 L505F probably damaging Het
Ccnt2 A G 1: 127,803,228 K614R probably benign Het
Col25a1 A G 3: 130,478,983 probably null Het
Copa T A 1: 172,118,944 L976* probably null Het
Ddx39b T C 17: 35,251,311 V267A probably benign Het
Doxl2 A G 6: 48,976,322 T394A possibly damaging Het
Dpp4 T A 2: 62,334,311 Q709L probably damaging Het
Exoc3 A G 13: 74,174,015 L647P probably benign Het
Eya4 T C 10: 23,140,077 S308G possibly damaging Het
Fbxo41 T C 6: 85,477,656 T693A possibly damaging Het
Fcgbp A G 7: 28,092,022 T903A possibly damaging Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Frem2 A G 3: 53,652,505 I1527T possibly damaging Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
H13 T A 2: 152,688,955 I220N probably damaging Het
Has2 T C 15: 56,667,916 R468G probably damaging Het
Ighmbp2 A G 19: 3,274,538 S243P probably damaging Het
Irs1 T C 1: 82,288,734 H587R probably benign Het
Kcnk1 C T 8: 126,025,405 T250M probably damaging Het
Kif9 T C 9: 110,510,464 V458A probably benign Het
Krt14 T C 11: 100,205,625 T208A probably benign Het
Mybpc3 C A 2: 91,124,849 H349Q possibly damaging Het
Neurl3 T A 1: 36,266,506 T207S possibly damaging Het
Nol9 T C 4: 152,050,574 V388A probably damaging Het
Notch3 T C 17: 32,157,987 N315D probably damaging Het
Oas1h G T 5: 120,870,982 A252S probably damaging Het
Olfr156 C A 4: 43,821,183 M59I probably damaging Het
Pcbp1 G A 6: 86,525,152 T255M possibly damaging Het
Plec A G 15: 76,199,608 V18A probably benign Het
Ppp1r17 A T 6: 56,026,544 E114V probably damaging Het
Scamp5 A T 9: 57,445,433 M151K possibly damaging Het
Sestd1 T C 2: 77,218,168 Y135C possibly damaging Het
Slc22a21 T G 11: 53,951,349 K534N probably benign Het
Slc25a12 T C 2: 71,282,573 E448G probably damaging Het
Slco3a1 A G 7: 74,346,818 L280P probably damaging Het
Sppl2b C A 10: 80,866,045 probably null Het
Srd5a2 T C 17: 74,027,019 E135G possibly damaging Het
Tfg A T 16: 56,701,104 M183K probably damaging Het
Ticrr G A 7: 79,679,133 M673I probably benign Het
Tm4sf20 T G 1: 82,768,237 M61L probably benign Het
Ttll8 A T 15: 88,939,006 S85T possibly damaging Het
Uggt2 G A 14: 119,042,726 S780F probably damaging Het
Uroc1 T C 6: 90,347,320 L442P probably damaging Het
Znrf3 A G 11: 5,289,006 probably benign Het
Zswim2 C A 2: 83,925,183 D125Y possibly damaging Het
Other mutations in Eno4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01672:Eno4 APN 19 58943545 missense possibly damaging 0.92
IGL02486:Eno4 APN 19 58945665 splice site probably null
IGL03087:Eno4 APN 19 58962816 missense possibly damaging 0.55
IGL03207:Eno4 APN 19 58953205 missense probably benign 0.04
R0048:Eno4 UTSW 19 58964538 missense possibly damaging 0.70
R0052:Eno4 UTSW 19 58968553 missense probably damaging 1.00
R0052:Eno4 UTSW 19 58968553 missense probably damaging 1.00
R0362:Eno4 UTSW 19 58943624 splice site probably benign
R2376:Eno4 UTSW 19 58953226 missense probably benign
R4387:Eno4 UTSW 19 58953208 missense probably benign 0.01
R4678:Eno4 UTSW 19 58946749 missense probably damaging 0.99
R4696:Eno4 UTSW 19 58945636 missense probably damaging 0.96
R4896:Eno4 UTSW 19 58964543 missense probably damaging 1.00
R4932:Eno4 UTSW 19 58964457 missense possibly damaging 0.82
R5050:Eno4 UTSW 19 58955496 missense probably benign 0.00
R5092:Eno4 UTSW 19 58945591 missense probably benign 0.02
R5104:Eno4 UTSW 19 58945541 missense probably benign 0.05
R5300:Eno4 UTSW 19 58955550 critical splice donor site probably null
R5450:Eno4 UTSW 19 58960247 missense possibly damaging 0.65
R5689:Eno4 UTSW 19 58970656 missense probably benign 0.01
R5874:Eno4 UTSW 19 58946806 missense probably benign
R6027:Eno4 UTSW 19 58946830 missense probably damaging 1.00
R6316:Eno4 UTSW 19 58960291 critical splice donor site probably null
R6494:Eno4 UTSW 19 58962794 missense probably damaging 1.00
R6706:Eno4 UTSW 19 58970680 missense probably benign 0.02
R7779:Eno4 UTSW 19 58968543 missense probably benign 0.19
R8169:Eno4 UTSW 19 58946652 missense probably benign
R8879:Eno4 UTSW 19 58970722 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ATGGCTCTTCACTGTGAGCG -3'
(R):5'- GACTGCATTTCCCTGAAATACC -3'

Sequencing Primer
(F):5'- CCCTGTGGAAATACTGAGCTTACAG -3'
(R):5'- ACCAATTCATCATAAAAGCGGTG -3'
Posted On2017-01-03