Incidental Mutation 'R5700:Nckap5'
ID450825
Institutional Source Beutler Lab
Gene Symbol Nckap5
Ensembl Gene ENSMUSG00000049690
Gene NameNCK-associated protein 5
SynonymsE030049G20Rik, LOC380609, D130011D22Rik
MMRRC Submission 043328-MU
Accession Numbers

Genbank: NM_001081756, NM_172484, NM_176957

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5700 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location125913620-126830799 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 125976925 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057846] [ENSMUST00000094609] [ENSMUST00000094610] [ENSMUST00000112583] [ENSMUST00000161954] [ENSMUST00000162877]
Predicted Effect probably null
Transcript: ENSMUST00000057846
SMART Domains Protein: ENSMUSP00000062229
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
coiled coil region 108 186 N/A INTRINSIC
low complexity region 321 332 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 950 971 N/A INTRINSIC
low complexity region 1070 1085 N/A INTRINSIC
low complexity region 1181 1200 N/A INTRINSIC
Pfam:NCKAP5 1298 1602 1.8e-120 PFAM
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1757 1771 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094609
SMART Domains Protein: ENSMUSP00000092192
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
low complexity region 70 93 N/A INTRINSIC
Pfam:NCKAP5 113 364 3.6e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000094610
SMART Domains Protein: ENSMUSP00000092193
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
Pfam:NCKAP5 1 101 8.8e-42 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000112583
SMART Domains Protein: ENSMUSP00000108202
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
low complexity region 70 93 N/A INTRINSIC
coiled coil region 176 254 N/A INTRINSIC
low complexity region 301 324 N/A INTRINSIC
low complexity region 453 464 N/A INTRINSIC
low complexity region 887 903 N/A INTRINSIC
low complexity region 1082 1103 N/A INTRINSIC
low complexity region 1202 1217 N/A INTRINSIC
low complexity region 1313 1332 N/A INTRINSIC
Pfam:NCKAP5 1431 1733 5.3e-119 PFAM
low complexity region 1860 1874 N/A INTRINSIC
low complexity region 1889 1903 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161954
SMART Domains Protein: ENSMUSP00000125624
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
coiled coil region 108 186 N/A INTRINSIC
low complexity region 233 256 N/A INTRINSIC
low complexity region 385 396 N/A INTRINSIC
low complexity region 819 835 N/A INTRINSIC
low complexity region 1014 1035 N/A INTRINSIC
low complexity region 1134 1149 N/A INTRINSIC
low complexity region 1245 1264 N/A INTRINSIC
Pfam:NCKAP5 1362 1666 2.1e-120 PFAM
low complexity region 1792 1806 N/A INTRINSIC
low complexity region 1821 1835 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162877
SMART Domains Protein: ENSMUSP00000124748
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
Pfam:NCKAP5 9 296 6e-36 PFAM
Meta Mutation Damage Score 0.9480 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (50/51)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,798,194 Q155L probably benign Het
Acadvl A C 11: 70,013,203 Y242D probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Barx2 A T 9: 31,858,765 F156I probably damaging Het
Best1 T C 19: 9,997,199 probably benign Het
Btbd8 T C 5: 107,503,648 S136P possibly damaging Het
Btla T A 16: 45,250,573 Y298* probably null Het
Casr T A 16: 36,509,617 I452F probably damaging Het
Ccser1 C A 6: 61,311,276 P141H probably benign Het
Cr2 A G 1: 195,159,757 V296A probably damaging Het
Csl T A 10: 99,759,015 I63F probably damaging Het
Dbt G A 3: 116,520,303 V40M probably damaging Het
Fam53b A T 7: 132,760,020 L93Q probably damaging Het
Fdps T C 3: 89,095,649 I105V probably damaging Het
Gm4884 A G 7: 41,043,219 D204G probably benign Het
Gm5592 A G 7: 41,158,579 probably benign Het
Gm7367 A T 7: 60,155,762 noncoding transcript Het
Grid2 T A 6: 64,094,432 V413D possibly damaging Het
Hgf C T 5: 16,610,124 P471L probably damaging Het
Hoxc9 T C 15: 102,981,881 Y77H possibly damaging Het
Hs6st3 C T 14: 119,138,787 R125* probably null Het
Kdm4b T C 17: 56,351,700 I15T possibly damaging Het
Klhl1 T C 14: 96,518,040 N93S probably benign Het
Klhl6 G A 16: 19,957,218 Q197* probably null Het
Medag T C 5: 149,422,217 V7A probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Obscn T C 11: 59,133,194 K550R probably benign Het
Olfr1369-ps1 T A 13: 21,116,001 V103E probably damaging Het
Olfr193 T A 16: 59,109,993 I206F probably damaging Het
Olfr716 A G 7: 107,147,541 N75S probably benign Het
Olfr8 T C 10: 78,955,484 I93T probably damaging Het
Parp6 T C 9: 59,624,727 S101P probably damaging Het
Plcd3 T C 11: 103,073,763 N594S probably benign Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Ppp2r1b T C 9: 50,878,157 Y443H probably damaging Het
Pqlc2 C T 4: 139,300,254 S259N probably damaging Het
Prnd G A 2: 131,953,343 V128I probably benign Het
Rftn1 G T 17: 50,002,669 P156Q probably damaging Het
Scmh1 T C 4: 120,516,946 V445A probably benign Het
Serpinb6c A T 13: 33,899,308 M41K probably damaging Het
Spns1 A G 7: 126,372,469 V303A possibly damaging Het
Ston1 T A 17: 88,644,339 S639R probably damaging Het
Thbs4 T C 13: 92,776,953 D153G probably benign Het
Timm44 T C 8: 4,274,171 Y36C probably damaging Het
Trim34b G T 7: 104,336,411 V418F probably damaging Het
Vmn1r72 C T 7: 11,670,423 V33M probably damaging Het
Zcchc7 T C 4: 44,931,084 V412A probably benign Het
Zfand1 T A 3: 10,341,019 N210I probably damaging Het
Zfhx3 A G 8: 108,933,867 H1251R probably damaging Het
Other mutations in Nckap5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Nckap5 APN 1 126027152 missense probably damaging 0.99
IGL00956:Nckap5 APN 1 126025018 missense probably damaging 0.98
IGL01414:Nckap5 APN 1 126528713 missense probably damaging 1.00
IGL01482:Nckap5 APN 1 126023160 missense probably damaging 1.00
IGL01508:Nckap5 APN 1 126025572 missense probably damaging 0.96
IGL02071:Nckap5 APN 1 125981568 missense probably damaging 0.97
IGL02129:Nckap5 APN 1 126027695 nonsense probably null
IGL02821:Nckap5 APN 1 126027816 missense probably damaging 1.00
IGL03174:Nckap5 APN 1 125981646 missense probably damaging 1.00
F5493:Nckap5 UTSW 1 126025827 missense probably benign
G5030:Nckap5 UTSW 1 126025854 missense probably damaging 0.96
R0033:Nckap5 UTSW 1 125940242 intron probably benign
R0164:Nckap5 UTSW 1 126024407 missense possibly damaging 0.84
R0164:Nckap5 UTSW 1 126024407 missense possibly damaging 0.84
R0349:Nckap5 UTSW 1 126026434 missense probably benign
R0482:Nckap5 UTSW 1 126026365 missense possibly damaging 0.92
R0508:Nckap5 UTSW 1 125981384 splice site probably null
R0541:Nckap5 UTSW 1 126695722 missense possibly damaging 0.82
R0609:Nckap5 UTSW 1 126027288 nonsense probably null
R0701:Nckap5 UTSW 1 126025357 missense probably benign 0.06
R0782:Nckap5 UTSW 1 125981541 missense probably damaging 1.00
R1389:Nckap5 UTSW 1 126026710 missense probably damaging 0.99
R1401:Nckap5 UTSW 1 126014661 splice site probably benign
R1436:Nckap5 UTSW 1 126026061 missense possibly damaging 0.96
R1506:Nckap5 UTSW 1 126025913 nonsense probably null
R1528:Nckap5 UTSW 1 126024922 missense possibly damaging 0.68
R1942:Nckap5 UTSW 1 126024302 missense probably damaging 1.00
R1968:Nckap5 UTSW 1 126014630 missense probably damaging 0.99
R2055:Nckap5 UTSW 1 126026898 missense probably damaging 1.00
R2105:Nckap5 UTSW 1 126026518 missense probably damaging 1.00
R2214:Nckap5 UTSW 1 126025750 missense possibly damaging 0.77
R2311:Nckap5 UTSW 1 126528752 missense probably damaging 1.00
R2403:Nckap5 UTSW 1 126027409 missense probably benign 0.18
R2430:Nckap5 UTSW 1 125914757 missense probably damaging 0.99
R2914:Nckap5 UTSW 1 126026537 splice site probably null
R3782:Nckap5 UTSW 1 126025074 missense possibly damaging 0.93
R4133:Nckap5 UTSW 1 126222706 missense probably benign 0.13
R4249:Nckap5 UTSW 1 126027639 missense probably benign 0.01
R4448:Nckap5 UTSW 1 126025726 nonsense probably null
R4456:Nckap5 UTSW 1 125914735 unclassified probably benign
R4682:Nckap5 UTSW 1 126102542 critical splice donor site probably null
R4817:Nckap5 UTSW 1 126027215 missense possibly damaging 0.68
R4907:Nckap5 UTSW 1 126026152 missense possibly damaging 0.92
R4908:Nckap5 UTSW 1 126027587 missense probably damaging 1.00
R4924:Nckap5 UTSW 1 126027028 nonsense probably null
R4926:Nckap5 UTSW 1 126528641 intron probably benign
R5032:Nckap5 UTSW 1 125977049 missense possibly damaging 0.62
R5133:Nckap5 UTSW 1 126033960 missense probably benign 0.01
R5197:Nckap5 UTSW 1 126222673 missense possibly damaging 0.79
R5238:Nckap5 UTSW 1 126027724 missense probably damaging 0.96
R5257:Nckap5 UTSW 1 126024508 missense probably damaging 0.99
R5277:Nckap5 UTSW 1 126026540 nonsense probably null
R5512:Nckap5 UTSW 1 126027744 missense possibly damaging 0.63
R5789:Nckap5 UTSW 1 126027702 missense probably damaging 1.00
R6029:Nckap5 UTSW 1 126025786 missense possibly damaging 0.89
R6249:Nckap5 UTSW 1 126024930 missense probably benign
R6292:Nckap5 UTSW 1 125915015 missense probably damaging 0.99
R6521:Nckap5 UTSW 1 126382172 missense probably damaging 1.00
R6875:Nckap5 UTSW 1 126023194 missense probably benign 0.03
R7017:Nckap5 UTSW 1 126102661 missense probably damaging 1.00
R7018:Nckap5 UTSW 1 126025048 missense probably damaging 0.99
R7054:Nckap5 UTSW 1 126258712 splice site probably null
R7204:Nckap5 UTSW 1 126026367 missense probably benign
R7336:Nckap5 UTSW 1 126026049 missense probably benign 0.00
R7544:Nckap5 UTSW 1 126026211 missense possibly damaging 0.92
R7590:Nckap5 UTSW 1 126026533 missense probably benign 0.00
R7684:Nckap5 UTSW 1 126026857 missense probably benign 0.00
R7749:Nckap5 UTSW 1 126024646 missense probably damaging 1.00
R7773:Nckap5 UTSW 1 126026844 missense probably benign 0.00
R7813:Nckap5 UTSW 1 126025426 missense probably benign 0.10
R7970:Nckap5 UTSW 1 126025021 nonsense probably null
R7992:Nckap5 UTSW 1 126026810 missense probably damaging 0.99
R8278:Nckap5 UTSW 1 126027772 missense probably damaging 1.00
R8373:Nckap5 UTSW 1 126026295 missense probably benign 0.02
R8414:Nckap5 UTSW 1 126014620 missense probably damaging 1.00
Z1088:Nckap5 UTSW 1 126024832 missense possibly damaging 0.76
Z1176:Nckap5 UTSW 1 126528681 critical splice donor site probably null
Z1177:Nckap5 UTSW 1 126222659 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCCACAGAAATTGAAATGAAAACAC -3'
(R):5'- TTTCCCTAAATTTGTTAAAGGTTGGT -3'

Sequencing Primer
(F):5'- ACTGTGGACTGAAATCCCTTG -3'
(R):5'- AAAGGTTGGTAAATCTTGGTTTTGG -3'
Posted On2017-01-03