Incidental Mutation 'R5700:Fdps'
ID450830
Institutional Source Beutler Lab
Gene Symbol Fdps
Ensembl Gene ENSMUSG00000059743
Gene Namefarnesyl diphosphate synthetase
Synonyms6030492I17Rik, Fdpsl1
MMRRC Submission 043328-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R5700 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location89093588-89101959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89095649 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 105 (I105V)
Ref Sequence ENSEMBL: ENSMUSP00000142393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052539] [ENSMUST00000081848] [ENSMUST00000090929] [ENSMUST00000196254] [ENSMUST00000196709] [ENSMUST00000196921] [ENSMUST00000199668] [ENSMUST00000200659]
Predicted Effect probably benign
Transcript: ENSMUST00000052539
SMART Domains Protein: ENSMUSP00000056640
Gene: ENSMUSG00000041263

DomainStartEndE-ValueType
low complexity region 95 117 N/A INTRINSIC
low complexity region 149 165 N/A INTRINSIC
low complexity region 374 383 N/A INTRINSIC
low complexity region 389 402 N/A INTRINSIC
low complexity region 429 440 N/A INTRINSIC
low complexity region 577 588 N/A INTRINSIC
RUN 589 657 2.75e-16 SMART
low complexity region 669 683 N/A INTRINSIC
low complexity region 702 714 N/A INTRINSIC
low complexity region 753 770 N/A INTRINSIC
SH3 838 893 4.32e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000081848
AA Change: I105V

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080531
Gene: ENSMUSG00000059743
AA Change: I105V

DomainStartEndE-ValueType
Pfam:polyprenyl_synt 47 313 2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090929
SMART Domains Protein: ENSMUSP00000088447
Gene: ENSMUSG00000041263

DomainStartEndE-ValueType
low complexity region 95 117 N/A INTRINSIC
low complexity region 149 165 N/A INTRINSIC
internal_repeat_1 195 244 5.11e-5 PROSPERO
internal_repeat_1 247 292 5.11e-5 PROSPERO
low complexity region 374 383 N/A INTRINSIC
low complexity region 389 402 N/A INTRINSIC
low complexity region 429 440 N/A INTRINSIC
low complexity region 463 479 N/A INTRINSIC
low complexity region 522 543 N/A INTRINSIC
low complexity region 546 584 N/A INTRINSIC
low complexity region 714 725 N/A INTRINSIC
RUN 726 794 2.75e-16 SMART
low complexity region 806 820 N/A INTRINSIC
low complexity region 839 851 N/A INTRINSIC
low complexity region 890 907 N/A INTRINSIC
SH3 975 1030 4.32e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000103960
Predicted Effect possibly damaging
Transcript: ENSMUST00000196254
AA Change: I11V

PolyPhen 2 Score 0.713 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142669
Gene: ENSMUSG00000059743
AA Change: I11V

DomainStartEndE-ValueType
Pfam:polyprenyl_synt 1 238 3.6e-60 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000196709
AA Change: I105V

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142770
Gene: ENSMUSG00000059743
AA Change: I105V

DomainStartEndE-ValueType
Pfam:polyprenyl_synt 44 316 8.7e-84 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000196921
AA Change: I172V

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142704
Gene: ENSMUSG00000059743
AA Change: I172V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:polyprenyl_synt 111 226 7.9e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198239
Predicted Effect probably damaging
Transcript: ENSMUST00000199668
AA Change: I105V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142393
Gene: ENSMUSG00000059743
AA Change: I105V

DomainStartEndE-ValueType
Pfam:polyprenyl_synt 44 121 3.2e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200433
Predicted Effect probably benign
Transcript: ENSMUST00000200659
AA Change: I172V

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000142694
Gene: ENSMUSG00000105204
AA Change: I172V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:polyprenyl_synt 111 334 3.2e-55 PFAM
low complexity region 548 559 N/A INTRINSIC
RUN 560 628 9.3e-19 SMART
low complexity region 640 654 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 724 741 N/A INTRINSIC
SH3 809 862 2.8e-10 SMART
Meta Mutation Damage Score 0.3491 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the production of geranyl pyrophosphate and farnesyl pyrophosphate from isopentenyl pyrophosphate and dimethylallyl pyrophosphate. The resulting product, farnesyl pyrophosphate, is a key intermediate in cholesterol and sterol biosynthesis, a substrate for protein farnesylation and geranylgeranylation, and a ligand or agonist for certain hormone receptors and growth receptors. Drugs that inhibit this enzyme prevent the post-translational modifications of small GTPases and have been used to treat diseases related to bone resorption. Multiple pseudogenes have been found on chromosomes 1, 7, 14, 15, 21 and X. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,798,194 Q155L probably benign Het
Acadvl A C 11: 70,013,203 Y242D probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Barx2 A T 9: 31,858,765 F156I probably damaging Het
Best1 T C 19: 9,997,199 probably benign Het
Btbd8 T C 5: 107,503,648 S136P possibly damaging Het
Btla T A 16: 45,250,573 Y298* probably null Het
Casr T A 16: 36,509,617 I452F probably damaging Het
Ccser1 C A 6: 61,311,276 P141H probably benign Het
Cr2 A G 1: 195,159,757 V296A probably damaging Het
Csl T A 10: 99,759,015 I63F probably damaging Het
Dbt G A 3: 116,520,303 V40M probably damaging Het
Fam53b A T 7: 132,760,020 L93Q probably damaging Het
Gm4884 A G 7: 41,043,219 D204G probably benign Het
Gm5592 A G 7: 41,158,579 probably benign Het
Gm7367 A T 7: 60,155,762 noncoding transcript Het
Grid2 T A 6: 64,094,432 V413D possibly damaging Het
Hgf C T 5: 16,610,124 P471L probably damaging Het
Hoxc9 T C 15: 102,981,881 Y77H possibly damaging Het
Hs6st3 C T 14: 119,138,787 R125* probably null Het
Kdm4b T C 17: 56,351,700 I15T possibly damaging Het
Klhl1 T C 14: 96,518,040 N93S probably benign Het
Klhl6 G A 16: 19,957,218 Q197* probably null Het
Medag T C 5: 149,422,217 V7A probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Nckap5 C T 1: 125,976,925 probably null Het
Obscn T C 11: 59,133,194 K550R probably benign Het
Olfr1369-ps1 T A 13: 21,116,001 V103E probably damaging Het
Olfr193 T A 16: 59,109,993 I206F probably damaging Het
Olfr716 A G 7: 107,147,541 N75S probably benign Het
Olfr8 T C 10: 78,955,484 I93T probably damaging Het
Parp6 T C 9: 59,624,727 S101P probably damaging Het
Plcd3 T C 11: 103,073,763 N594S probably benign Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Ppp2r1b T C 9: 50,878,157 Y443H probably damaging Het
Pqlc2 C T 4: 139,300,254 S259N probably damaging Het
Prnd G A 2: 131,953,343 V128I probably benign Het
Rftn1 G T 17: 50,002,669 P156Q probably damaging Het
Scmh1 T C 4: 120,516,946 V445A probably benign Het
Serpinb6c A T 13: 33,899,308 M41K probably damaging Het
Spns1 A G 7: 126,372,469 V303A possibly damaging Het
Ston1 T A 17: 88,644,339 S639R probably damaging Het
Thbs4 T C 13: 92,776,953 D153G probably benign Het
Timm44 T C 8: 4,274,171 Y36C probably damaging Het
Trim34b G T 7: 104,336,411 V418F probably damaging Het
Vmn1r72 C T 7: 11,670,423 V33M probably damaging Het
Zcchc7 T C 4: 44,931,084 V412A probably benign Het
Zfand1 T A 3: 10,341,019 N210I probably damaging Het
Zfhx3 A G 8: 108,933,867 H1251R probably damaging Het
Other mutations in Fdps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Fdps APN 3 89094442 splice site probably benign
IGL01364:Fdps APN 3 89094270 nonsense probably null
broadside UTSW 3 89100761 missense probably damaging 1.00
R0245:Fdps UTSW 3 89093771 missense possibly damaging 0.84
R0385:Fdps UTSW 3 89094894 missense probably damaging 1.00
R1674:Fdps UTSW 3 89100730 missense probably benign 0.33
R1820:Fdps UTSW 3 89095043 missense probably benign
R4467:Fdps UTSW 3 89100786 missense possibly damaging 0.71
R5106:Fdps UTSW 3 89099403 missense probably damaging 0.99
R6128:Fdps UTSW 3 89099433 missense possibly damaging 0.77
R6791:Fdps UTSW 3 89095352 critical splice donor site probably null
R6800:Fdps UTSW 3 89100761 missense probably damaging 1.00
R6812:Fdps UTSW 3 89094476 missense possibly damaging 0.51
R6927:Fdps UTSW 3 89093651 missense probably benign 0.41
R7585:Fdps UTSW 3 89093806 missense probably benign 0.17
R7599:Fdps UTSW 3 89099386 missense probably benign 0.05
R7691:Fdps UTSW 3 89099367 missense probably benign 0.01
R7709:Fdps UTSW 3 89101090 missense probably damaging 0.97
R8035:Fdps UTSW 3 89095476 missense probably benign 0.04
R8132:Fdps UTSW 3 89099386 nonsense probably null
R8297:Fdps UTSW 3 89093741 missense probably damaging 0.99
R8323:Fdps UTSW 3 89095389 missense possibly damaging 0.93
X0060:Fdps UTSW 3 89094314 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- ATGCCTGGCTGTTAGGAAC -3'
(R):5'- TCTAGAGCCTGTTAGAGGTGC -3'

Sequencing Primer
(F):5'- CAGTGTGAAACAAGTTACTGCTGGC -3'
(R):5'- GCCTGTTAGAGGTGCCAGAG -3'
Posted On2017-01-03