Incidental Mutation 'R5700:Scmh1'
ID 450834
Institutional Source Beutler Lab
Gene Symbol Scmh1
Ensembl Gene ENSMUSG00000000085
Gene Name sex comb on midleg homolog 1
Synonyms Scml3
MMRRC Submission 043328-MU
Accession Numbers

Ncbi RefSeq: NM_013883.2, NM_001159630.1; MGI:1352762

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5700 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 120405281-120530186 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 120516946 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 445 (V445A)
Ref Sequence ENSEMBL: ENSMUSP00000101908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000087] [ENSMUST00000064991] [ENSMUST00000106298] [ENSMUST00000106301]
AlphaFold Q8K214
Predicted Effect probably benign
Transcript: ENSMUST00000000087
AA Change: V445A

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000000087
Gene: ENSMUSG00000000085
AA Change: V445A

DomainStartEndE-ValueType
MBT 28 126 2.47e-48 SMART
MBT 134 235 1.36e-45 SMART
low complexity region 268 285 N/A INTRINSIC
low complexity region 301 340 N/A INTRINSIC
Pfam:DUF3588 354 468 4.3e-50 PFAM
SAM 594 662 1.8e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000064991
AA Change: V445A

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000069813
Gene: ENSMUSG00000000085
AA Change: V445A

DomainStartEndE-ValueType
MBT 28 126 2.47e-48 SMART
MBT 134 235 1.36e-45 SMART
low complexity region 268 285 N/A INTRINSIC
low complexity region 301 340 N/A INTRINSIC
Pfam:DUF3588 357 465 5.8e-39 PFAM
SAM 594 662 1.57e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106298
AA Change: V445A

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101905
Gene: ENSMUSG00000000085
AA Change: V445A

DomainStartEndE-ValueType
MBT 28 126 2.47e-48 SMART
MBT 134 235 1.36e-45 SMART
low complexity region 268 285 N/A INTRINSIC
low complexity region 301 340 N/A INTRINSIC
Pfam:DUF3588 354 468 4.3e-50 PFAM
SAM 594 662 1.8e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106301
AA Change: V445A

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101908
Gene: ENSMUSG00000000085
AA Change: V445A

DomainStartEndE-ValueType
MBT 28 126 2.47e-48 SMART
MBT 134 235 1.36e-45 SMART
low complexity region 268 285 N/A INTRINSIC
low complexity region 301 340 N/A INTRINSIC
Pfam:DUF3588 354 468 4.7e-50 PFAM
SAM 594 662 1.57e-10 SMART
Predicted Effect unknown
Transcript: ENSMUST00000122860
AA Change: V99A
SMART Domains Protein: ENSMUSP00000120950
Gene: ENSMUSG00000000085
AA Change: V99A

DomainStartEndE-ValueType
Pfam:DUF3588 60 120 4.3e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144555
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144862
Meta Mutation Damage Score 0.0844 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (50/51)
MGI Phenotype Strain: 3706668
PHENOTYPE: Mice homozygous for an allele lacking the SPM domain exhibit partial penetrance of posterior vertebral transformations and male infertility with azoospermia and arrest of spermatogenesis. Mice homozygous for a knock-out allele exhibit abnormal hematopoiesis but normal fertility and skeleton. [provided by MGI curators]
Allele List at MGI

All alleles(67) : Targeted(4) Gene trapped(63)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,798,194 Q155L probably benign Het
Acadvl A C 11: 70,013,203 Y242D probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Barx2 A T 9: 31,858,765 F156I probably damaging Het
Best1 T C 19: 9,997,199 probably benign Het
Btbd8 T C 5: 107,503,648 S136P possibly damaging Het
Btla T A 16: 45,250,573 Y298* probably null Het
Casr T A 16: 36,509,617 I452F probably damaging Het
Ccser1 C A 6: 61,311,276 P141H probably benign Het
Cr2 A G 1: 195,159,757 V296A probably damaging Het
Csl T A 10: 99,759,015 I63F probably damaging Het
Dbt G A 3: 116,520,303 V40M probably damaging Het
Fam53b A T 7: 132,760,020 L93Q probably damaging Het
Fdps T C 3: 89,095,649 I105V probably damaging Het
Gm4884 A G 7: 41,043,219 D204G probably benign Het
Gm5592 A G 7: 41,158,579 probably benign Het
Gm7367 A T 7: 60,155,762 noncoding transcript Het
Grid2 T A 6: 64,094,432 V413D possibly damaging Het
Hgf C T 5: 16,610,124 P471L probably damaging Het
Hoxc9 T C 15: 102,981,881 Y77H possibly damaging Het
Hs6st3 C T 14: 119,138,787 R125* probably null Het
Kdm4b T C 17: 56,351,700 I15T possibly damaging Het
Klhl1 T C 14: 96,518,040 N93S probably benign Het
Klhl6 G A 16: 19,957,218 Q197* probably null Het
Medag T C 5: 149,422,217 V7A probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Nckap5 C T 1: 125,976,925 probably null Het
Obscn T C 11: 59,133,194 K550R probably benign Het
Olfr1369-ps1 T A 13: 21,116,001 V103E probably damaging Het
Olfr193 T A 16: 59,109,993 I206F probably damaging Het
Olfr716 A G 7: 107,147,541 N75S probably benign Het
Olfr8 T C 10: 78,955,484 I93T probably damaging Het
Parp6 T C 9: 59,624,727 S101P probably damaging Het
Plcd3 T C 11: 103,073,763 N594S probably benign Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Ppp2r1b T C 9: 50,878,157 Y443H probably damaging Het
Pqlc2 C T 4: 139,300,254 S259N probably damaging Het
Prnd G A 2: 131,953,343 V128I probably benign Het
Rftn1 G T 17: 50,002,669 P156Q probably damaging Het
Serpinb6c A T 13: 33,899,308 M41K probably damaging Het
Spns1 A G 7: 126,372,469 V303A possibly damaging Het
Ston1 T A 17: 88,644,339 S639R probably damaging Het
Thbs4 T C 13: 92,776,953 D153G probably benign Het
Timm44 T C 8: 4,274,171 Y36C probably damaging Het
Trim34b G T 7: 104,336,411 V418F probably damaging Het
Vmn1r72 C T 7: 11,670,423 V33M probably damaging Het
Zcchc7 T C 4: 44,931,084 V412A probably benign Het
Zfand1 T A 3: 10,341,019 N210I probably damaging Het
Zfhx3 A G 8: 108,933,867 H1251R probably damaging Het
Other mutations in Scmh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01613:Scmh1 APN 4 120529900 utr 3 prime probably benign
IGL01962:Scmh1 APN 4 120483584 splice site probably benign
IGL02013:Scmh1 APN 4 120483732 missense possibly damaging 0.77
IGL02081:Scmh1 APN 4 120515078 missense probably damaging 1.00
IGL02223:Scmh1 APN 4 120515219 missense probably benign 0.26
IGL02530:Scmh1 APN 4 120528146 splice site probably benign
IGL02887:Scmh1 APN 4 120468389 missense probably damaging 1.00
P0024:Scmh1 UTSW 4 120478034 missense probably damaging 1.00
R0164:Scmh1 UTSW 4 120529865 unclassified probably benign
R0164:Scmh1 UTSW 4 120529865 unclassified probably benign
R0200:Scmh1 UTSW 4 120483831 missense probably damaging 0.99
R1598:Scmh1 UTSW 4 120515130 missense possibly damaging 0.83
R1624:Scmh1 UTSW 4 120529228 missense probably damaging 1.00
R2276:Scmh1 UTSW 4 120483672 missense probably damaging 1.00
R3734:Scmh1 UTSW 4 120478080 missense probably damaging 1.00
R4167:Scmh1 UTSW 4 120529276 intron probably benign
R4570:Scmh1 UTSW 4 120528298 missense probably damaging 1.00
R5458:Scmh1 UTSW 4 120505281 unclassified probably benign
R5564:Scmh1 UTSW 4 120468378 missense probably damaging 1.00
R5991:Scmh1 UTSW 4 120522620 missense probably benign
R5999:Scmh1 UTSW 4 120505515 critical splice donor site probably null
R7097:Scmh1 UTSW 4 120525055 missense probably benign
R7432:Scmh1 UTSW 4 120529156 missense probably damaging 1.00
R8327:Scmh1 UTSW 4 120522502 missense probably benign
R8680:Scmh1 UTSW 4 120462134 missense probably benign
R8745:Scmh1 UTSW 4 120505362 nonsense probably null
R9018:Scmh1 UTSW 4 120505317 missense probably benign 0.01
R9141:Scmh1 UTSW 4 120505359 missense probably benign 0.00
R9283:Scmh1 UTSW 4 120462140 missense probably benign
R9426:Scmh1 UTSW 4 120505359 missense probably benign 0.00
R9454:Scmh1 UTSW 4 120515079 missense probably benign
R9487:Scmh1 UTSW 4 120463087 nonsense probably null
Z1176:Scmh1 UTSW 4 120478042 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCACTGCCTTTTGTAACCTG -3'
(R):5'- AAGGGCAGAAACCAGATCTC -3'

Sequencing Primer
(F):5'- TTTGTAACCTGCCAAGCCTAAG -3'
(R):5'- AACCAGATCTCCGGAGTGTG -3'
Posted On 2017-01-03