Mutagenetix > Incidental Mutation

Incidental Mutation 'R5700:Grid2'

450840

Institutional Source

Beutler Lab

Gene Symbol

Grid2

Ensembl Gene

ENSMUSG00000071424

Gene Name

glutamate receptor, ionotropic, delta 2

Synonyms

GluRdelta2, tpr, B230104L07Rik

MMRRC Submission

043328-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5700 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

63255876-64704323 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 64094432 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 413 (V413D)

Ref Sequence

ENSEMBL: ENSMUSP00000093536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095852]

AlphaFold

Q61625

Predicted Effect

possibly damaging
Transcript: ENSMUST00000095852
AA Change: V413D

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000093536
Gene: ENSMUSG00000071424
AA Change: V413D

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	39	404	4.1e-41	PFAM
PBPe	442	807	5.98e-108	SMART
Lig_chan-Glu_bd	452	514	3.76e-24	SMART
transmembrane domain	830	852	N/A	INTRINSIC
low complexity region	945	956	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159561

SMART Domains

Protein: ENSMUSP00000125402
Gene: ENSMUSG00000071424

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	39	404	2.7e-36	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161105

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162968

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203031

Meta Mutation Damage Score

0.4153

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the family of ionotropic glutamate receptors which are the predominant excitatory neurotransmitter receptors in the mammalian brain. The encoded protein is a multi-pass membrane protein that is expressed selectively in cerebellar Purkinje cells. A point mutation in the mouse ortholog, associated with the phenotype named 'lurcher', in the heterozygous state leads to ataxia resulting from selective, cell-autonomous apoptosis of cerebellar Purkinje cells during postnatal development. Mice homozygous for this mutation die shortly after birth from massive loss of mid- and hindbrain neurons during late embryogenesis. This protein also plays a role in synapse organization between parallel fibers and Purkinje cells. Alternate splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause cerebellar ataxia in humans. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygotes for multiple spontaneous and targeted null mutations exhibit ataxia and impaired locomotion associated with cerebellar Purkinje cell abnormalities and loss, and on some backgrounds, male infertility due to lack of zona penetration by sperm. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc2	A	T	19: 43,798,194	Q155L	probably benign	Het
Acadvl	A	C	11: 70,013,203	Y242D	probably damaging	Het
Armc8	A	G	9: 99,496,149		probably null	Het
Barx2	A	T	9: 31,858,765	F156I	probably damaging	Het
Best1	T	C	19: 9,997,199		probably benign	Het
Btbd8	T	C	5: 107,503,648	S136P	possibly damaging	Het
Btla	T	A	16: 45,250,573	Y298*	probably null	Het
Casr	T	A	16: 36,509,617	I452F	probably damaging	Het
Ccser1	C	A	6: 61,311,276	P141H	probably benign	Het
Cr2	A	G	1: 195,159,757	V296A	probably damaging	Het
Csl	T	A	10: 99,759,015	I63F	probably damaging	Het
Dbt	G	A	3: 116,520,303	V40M	probably damaging	Het
Fam53b	A	T	7: 132,760,020	L93Q	probably damaging	Het
Fdps	T	C	3: 89,095,649	I105V	probably damaging	Het
Gm4884	A	G	7: 41,043,219	D204G	probably benign	Het
Gm5592	A	G	7: 41,158,579		probably benign	Het
Gm7367	A	T	7: 60,155,762		noncoding transcript	Het
Hgf	C	T	5: 16,610,124	P471L	probably damaging	Het
Hoxc9	T	C	15: 102,981,881	Y77H	possibly damaging	Het
Hs6st3	C	T	14: 119,138,787	R125*	probably null	Het
Kdm4b	T	C	17: 56,351,700	I15T	possibly damaging	Het
Klhl1	T	C	14: 96,518,040	N93S	probably benign	Het
Klhl6	G	A	16: 19,957,218	Q197*	probably null	Het
Medag	T	C	5: 149,422,217	V7A	probably benign	Het
Mptx2	G	A	1: 173,274,847	L92F	probably benign	Het
Nckap5	C	T	1: 125,976,925		probably null	Het
Obscn	T	C	11: 59,133,194	K550R	probably benign	Het
Olfr1369-ps1	T	A	13: 21,116,001	V103E	probably damaging	Het
Olfr193	T	A	16: 59,109,993	I206F	probably damaging	Het
Olfr716	A	G	7: 107,147,541	N75S	probably benign	Het
Olfr8	T	C	10: 78,955,484	I93T	probably damaging	Het
Parp6	T	C	9: 59,624,727	S101P	probably damaging	Het
Plcd3	T	C	11: 103,073,763	N594S	probably benign	Het
Plscr5	A	T	9: 92,205,511	K178*	probably null	Het
Ppp2r1b	T	C	9: 50,878,157	Y443H	probably damaging	Het
Pqlc2	C	T	4: 139,300,254	S259N	probably damaging	Het
Prnd	G	A	2: 131,953,343	V128I	probably benign	Het
Rftn1	G	T	17: 50,002,669	P156Q	probably damaging	Het
Scmh1	T	C	4: 120,516,946	V445A	probably benign	Het
Serpinb6c	A	T	13: 33,899,308	M41K	probably damaging	Het
Spns1	A	G	7: 126,372,469	V303A	possibly damaging	Het
Ston1	T	A	17: 88,644,339	S639R	probably damaging	Het
Thbs4	T	C	13: 92,776,953	D153G	probably benign	Het
Timm44	T	C	8: 4,274,171	Y36C	probably damaging	Het
Trim34b	G	T	7: 104,336,411	V418F	probably damaging	Het
Vmn1r72	C	T	7: 11,670,423	V33M	probably damaging	Het
Zcchc7	T	C	4: 44,931,084	V412A	probably benign	Het
Zfand1	T	A	3: 10,341,019	N210I	probably damaging	Het
Zfhx3	A	G	8: 108,933,867	H1251R	probably damaging	Het

Other mutations in Grid2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00580:Grid2	APN	6	64345589	missense	probably damaging	1.00
IGL00596:Grid2	APN	6	64533704	missense	possibly damaging	0.93
IGL01686:Grid2	APN	6	64320196	missense	probably benign	0.00
IGL01712:Grid2	APN	6	64665915	missense	possibly damaging	0.73
IGL02064:Grid2	APN	6	64063935	missense	probably benign	0.29
IGL02216:Grid2	APN	6	64345666	missense	probably damaging	0.96
IGL02563:Grid2	APN	6	64345873	missense	possibly damaging	0.94
IGL02685:Grid2	APN	6	64345816	missense	possibly damaging	0.50
IGL03129:Grid2	APN	6	64063904	missense	probably damaging	0.98
IGL03324:Grid2	APN	6	64429822	missense	possibly damaging	0.88
IGL03395:Grid2	APN	6	63909069	missense	possibly damaging	0.94
crawler	UTSW	6	64429694	nonsense	probably null
swagger	UTSW	6	64395280	synonymous	probably benign
R0133:Grid2	UTSW	6	64320132	missense	probably damaging	1.00
R0147:Grid2	UTSW	6	64533587	missense	probably benign
R0193:Grid2	UTSW	6	64063953	missense	possibly damaging	0.64
R0370:Grid2	UTSW	6	64345734	missense	possibly damaging	0.75
R0399:Grid2	UTSW	6	64666052	missense	probably benign	0.33
R0600:Grid2	UTSW	6	63503435	missense	probably benign	0.38
R0717:Grid2	UTSW	6	64666275	missense	possibly damaging	0.96
R1524:Grid2	UTSW	6	64429754	missense	possibly damaging	0.92
R1555:Grid2	UTSW	6	64429684	missense	possibly damaging	0.87
R1572:Grid2	UTSW	6	64429694	nonsense	probably null
R1762:Grid2	UTSW	6	64533654	missense	probably damaging	0.98
R1944:Grid2	UTSW	6	63909061	missense	probably damaging	1.00
R1961:Grid2	UTSW	6	63908893	missense	probably damaging	1.00
R1969:Grid2	UTSW	6	63908918	nonsense	probably null
R2138:Grid2	UTSW	6	64345798	missense	probably damaging	0.99
R3500:Grid2	UTSW	6	63503399	missense	probably damaging	0.97
R3547:Grid2	UTSW	6	64320021	missense	probably damaging	0.97
R3845:Grid2	UTSW	6	64345842	missense	possibly damaging	0.62
R4124:Grid2	UTSW	6	63503433	missense	probably benign	0.41
R4273:Grid2	UTSW	6	63909045	missense	probably damaging	1.00
R4591:Grid2	UTSW	6	64320102	missense	probably damaging	1.00
R4701:Grid2	UTSW	6	64665915	missense	probably benign	0.27
R4721:Grid2	UTSW	6	64666201	missense	probably benign	0.33
R4755:Grid2	UTSW	6	63908988	missense	probably benign	0.04
R4869:Grid2	UTSW	6	64429740	missense	probably damaging	1.00
R5083:Grid2	UTSW	6	64320152	nonsense	probably null
R5091:Grid2	UTSW	6	64076878	missense	probably benign	0.07
R5117:Grid2	UTSW	6	63256933	missense	probably benign	0.15
R5128:Grid2	UTSW	6	64665998	missense	probably benign	0.01
R5386:Grid2	UTSW	6	63931105	missense	probably damaging	0.99
R5404:Grid2	UTSW	6	63930910	missense	probably damaging	0.99
R5534:Grid2	UTSW	6	63503361	missense	probably benign
R5626:Grid2	UTSW	6	64076945	critical splice donor site	probably null
R5699:Grid2	UTSW	6	63908991	missense	probably damaging	0.99
R5876:Grid2	UTSW	6	64663162	missense	probably damaging	1.00
R6446:Grid2	UTSW	6	64345593	missense	probably damaging	1.00
R6694:Grid2	UTSW	6	63931047	missense	possibly damaging	0.92
R6697:Grid2	UTSW	6	63931047	missense	possibly damaging	0.92
R6699:Grid2	UTSW	6	63931047	missense	possibly damaging	0.92
R6767:Grid2	UTSW	6	63931015	missense	probably benign	0.01
R6895:Grid2	UTSW	6	64395299	missense	probably damaging	0.99
R6999:Grid2	UTSW	6	64076909	missense	possibly damaging	0.80
R7053:Grid2	UTSW	6	64700418	missense	unknown
R7126:Grid2	UTSW	6	64076810	missense	probably damaging	0.99
R7432:Grid2	UTSW	6	64275870	missense	possibly damaging	0.46
R7553:Grid2	UTSW	6	64076941	missense	possibly damaging	0.95
R7619:Grid2	UTSW	6	63931101	missense	possibly damaging	0.71
R7997:Grid2	UTSW	6	64320136	missense	possibly damaging	0.89
R8112:Grid2	UTSW	6	63908907	missense	probably damaging	0.99
R8296:Grid2	UTSW	6	63256945	critical splice donor site	probably null
R8320:Grid2	UTSW	6	63256933	missense	probably benign	0.15
R8467:Grid2	UTSW	6	64533651	missense	probably benign	0.01
R8691:Grid2	UTSW	6	63503337	missense	probably damaging	0.97
R8890:Grid2	UTSW	6	63256939	missense	probably benign
R8965:Grid2	UTSW	6	64320006	missense	probably damaging	1.00
R8968:Grid2	UTSW	6	64666155	missense	probably benign	0.14
R9220:Grid2	UTSW	6	63908904	missense	probably damaging	1.00
R9371:Grid2	UTSW	6	64700522	missense	unknown
Z1176:Grid2	UTSW	6	63908879	missense	possibly damaging	0.76
Z1176:Grid2	UTSW	6	64663228	missense	probably benign	0.03
Z1177:Grid2	UTSW	6	64345856	nonsense	probably null
Z1177:Grid2	UTSW	6	64345857	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTCCTGGGTGTATTGTTCATCTAC -3'
(R):5'- GGGAAGCACTATGTTATTTCTCTTCAG -3'

Sequencing Primer
(F):5'- TTCCCTCATCTAGGGTGGA -3'
(R):5'- TGTCTAAGGAGTGCTCTC -3'

Posted On

2017-01-03