Incidental Mutation 'R5700:Vmn1r72'
ID450841
Institutional Source Beutler Lab
Gene Symbol Vmn1r72
Ensembl Gene ENSMUSG00000095430
Gene Namevomeronasal 1 receptor 72
SynonymsV1rg1
MMRRC Submission 043328-MU
Accession Numbers

Genbank: NM_145843; MGI: 2182256

Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R5700 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location11664479-11680147 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 11670423 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 33 (V33M)
Ref Sequence ENSEMBL: ENSMUSP00000154511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053134] [ENSMUST00000209638] [ENSMUST00000227010]
Predicted Effect probably damaging
Transcript: ENSMUST00000053134
AA Change: V33M

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000052997
Gene: ENSMUSG00000095430
AA Change: V33M

DomainStartEndE-ValueType
Pfam:TAS2R 1 305 1.8e-9 PFAM
Pfam:V1R 25 300 6.7e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209638
AA Change: V33M

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000227010
AA Change: V33M

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,798,194 Q155L probably benign Het
Acadvl A C 11: 70,013,203 Y242D probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Barx2 A T 9: 31,858,765 F156I probably damaging Het
Best1 T C 19: 9,997,199 probably benign Het
Btbd8 T C 5: 107,503,648 S136P possibly damaging Het
Btla T A 16: 45,250,573 Y298* probably null Het
Casr T A 16: 36,509,617 I452F probably damaging Het
Ccser1 C A 6: 61,311,276 P141H probably benign Het
Cr2 A G 1: 195,159,757 V296A probably damaging Het
Csl T A 10: 99,759,015 I63F probably damaging Het
Dbt G A 3: 116,520,303 V40M probably damaging Het
Fam53b A T 7: 132,760,020 L93Q probably damaging Het
Fdps T C 3: 89,095,649 I105V probably damaging Het
Gm4884 A G 7: 41,043,219 D204G probably benign Het
Gm5592 A G 7: 41,158,579 probably benign Het
Gm7367 A T 7: 60,155,762 noncoding transcript Het
Grid2 T A 6: 64,094,432 V413D possibly damaging Het
Hgf C T 5: 16,610,124 P471L probably damaging Het
Hoxc9 T C 15: 102,981,881 Y77H possibly damaging Het
Hs6st3 C T 14: 119,138,787 R125* probably null Het
Kdm4b T C 17: 56,351,700 I15T possibly damaging Het
Klhl1 T C 14: 96,518,040 N93S probably benign Het
Klhl6 G A 16: 19,957,218 Q197* probably null Het
Medag T C 5: 149,422,217 V7A probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Nckap5 C T 1: 125,976,925 probably null Het
Obscn T C 11: 59,133,194 K550R probably benign Het
Olfr1369-ps1 T A 13: 21,116,001 V103E probably damaging Het
Olfr193 T A 16: 59,109,993 I206F probably damaging Het
Olfr716 A G 7: 107,147,541 N75S probably benign Het
Olfr8 T C 10: 78,955,484 I93T probably damaging Het
Parp6 T C 9: 59,624,727 S101P probably damaging Het
Plcd3 T C 11: 103,073,763 N594S probably benign Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Ppp2r1b T C 9: 50,878,157 Y443H probably damaging Het
Pqlc2 C T 4: 139,300,254 S259N probably damaging Het
Prnd G A 2: 131,953,343 V128I probably benign Het
Rftn1 G T 17: 50,002,669 P156Q probably damaging Het
Scmh1 T C 4: 120,516,946 V445A probably benign Het
Serpinb6c A T 13: 33,899,308 M41K probably damaging Het
Spns1 A G 7: 126,372,469 V303A possibly damaging Het
Ston1 T A 17: 88,644,339 S639R probably damaging Het
Thbs4 T C 13: 92,776,953 D153G probably benign Het
Timm44 T C 8: 4,274,171 Y36C probably damaging Het
Trim34b G T 7: 104,336,411 V418F probably damaging Het
Zcchc7 T C 4: 44,931,084 V412A probably benign Het
Zfand1 T A 3: 10,341,019 N210I probably damaging Het
Zfhx3 A G 8: 108,933,867 H1251R probably damaging Het
Other mutations in Vmn1r72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Vmn1r72 APN 7 11670497 missense probably benign 0.41
IGL02375:Vmn1r72 APN 7 11669745 missense probably benign 0.10
IGL02809:Vmn1r72 APN 7 11670003 missense probably benign 0.03
IGL03104:Vmn1r72 APN 7 11669885 missense probably damaging 1.00
3-1:Vmn1r72 UTSW 7 11669898 missense probably damaging 0.97
IGL03014:Vmn1r72 UTSW 7 11669784 missense possibly damaging 0.80
R0346:Vmn1r72 UTSW 7 11669694 missense probably benign
R0524:Vmn1r72 UTSW 7 11669792 missense probably benign 0.32
R1951:Vmn1r72 UTSW 7 11669804 missense probably damaging 1.00
R1953:Vmn1r72 UTSW 7 11669804 missense probably damaging 1.00
R2181:Vmn1r72 UTSW 7 11669668 nonsense probably null
R4182:Vmn1r72 UTSW 7 11670068 missense probably benign 0.00
R4345:Vmn1r72 UTSW 7 11670036 missense possibly damaging 0.86
R4496:Vmn1r72 UTSW 7 11669864 missense probably damaging 1.00
R4999:Vmn1r72 UTSW 7 11670373 missense possibly damaging 0.63
R5401:Vmn1r72 UTSW 7 11669916 missense probably damaging 1.00
R5754:Vmn1r72 UTSW 7 11669849 missense probably damaging 0.99
R6292:Vmn1r72 UTSW 7 11669652 missense probably benign 0.02
R6439:Vmn1r72 UTSW 7 11679137 splice site probably null
R7616:Vmn1r72 UTSW 7 11670345 missense probably damaging 0.96
R7629:Vmn1r72 UTSW 7 11669784 missense probably benign
R7737:Vmn1r72 UTSW 7 11669707 missense probably damaging 0.98
R7819:Vmn1r72 UTSW 7 11669625 missense probably benign 0.01
R8358:Vmn1r72 UTSW 7 11670383 missense probably damaging 0.99
R8797:Vmn1r72 UTSW 7 11670038 missense probably benign
R8848:Vmn1r72 UTSW 7 11670342 missense probably damaging 0.98
R8947:Vmn1r72 UTSW 7 11669880 missense possibly damaging 0.89
X0063:Vmn1r72 UTSW 7 11669712 missense probably benign 0.00
Z1088:Vmn1r72 UTSW 7 11670173 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTGAAAGCAACTCAGTAGGCAC -3'
(R):5'- TCACTAGAAATGCACCATGACAATG -3'

Sequencing Primer
(F):5'- GCAACTCAGTAGGCACATTGC -3'
(R):5'- GCACCATGACAATGTATTTCTAGGG -3'
Posted On2017-01-03