Mutagenetix > Incidental Mutation

Incidental Mutation 'R5700:Gm4884'

450842

Institutional Source

Beutler Lab

Gene Symbol

Gm4884

Ensembl Gene

ENSMUSG00000048312

Gene Name

predicted gene 4884

Synonyms

MMRRC Submission

043328-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.070) question?

Stock #

R5700 (G1)

Quality Score

222

Status

Validated

Chromosome

Chromosomal Location

41032719-41045302 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 41043219 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 204 (D204G)

Ref Sequence

ENSEMBL: ENSMUSP00000133059 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164422]

AlphaFold

E9PVP9

Predicted Effect

probably benign
Transcript: ENSMUST00000164422
AA Change: D204G

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000133059
Gene: ENSMUSG00000048312
AA Change: D204G

Domain	Start	End	E-Value	Type
Pfam:DUF4629	243	387	8e-62	PFAM
low complexity region	509	533	N/A	INTRINSIC
internal_repeat_1	554	584	1.89e-11	PROSPERO
internal_repeat_1	583	613	1.89e-11	PROSPERO

Meta Mutation Damage Score

0.0726

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

98% (50/51)

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc2	A	T	19: 43,798,194	Q155L	probably benign	Het
Acadvl	A	C	11: 70,013,203	Y242D	probably damaging	Het
Armc8	A	G	9: 99,496,149		probably null	Het
Barx2	A	T	9: 31,858,765	F156I	probably damaging	Het
Best1	T	C	19: 9,997,199		probably benign	Het
Btbd8	T	C	5: 107,503,648	S136P	possibly damaging	Het
Btla	T	A	16: 45,250,573	Y298*	probably null	Het
Casr	T	A	16: 36,509,617	I452F	probably damaging	Het
Ccser1	C	A	6: 61,311,276	P141H	probably benign	Het
Cr2	A	G	1: 195,159,757	V296A	probably damaging	Het
Csl	T	A	10: 99,759,015	I63F	probably damaging	Het
Dbt	G	A	3: 116,520,303	V40M	probably damaging	Het
Fam53b	A	T	7: 132,760,020	L93Q	probably damaging	Het
Fdps	T	C	3: 89,095,649	I105V	probably damaging	Het
Gm5592	A	G	7: 41,158,579		probably benign	Het
Gm7367	A	T	7: 60,155,762		noncoding transcript	Het
Grid2	T	A	6: 64,094,432	V413D	possibly damaging	Het
Hgf	C	T	5: 16,610,124	P471L	probably damaging	Het
Hoxc9	T	C	15: 102,981,881	Y77H	possibly damaging	Het
Hs6st3	C	T	14: 119,138,787	R125*	probably null	Het
Kdm4b	T	C	17: 56,351,700	I15T	possibly damaging	Het
Klhl1	T	C	14: 96,518,040	N93S	probably benign	Het
Klhl6	G	A	16: 19,957,218	Q197*	probably null	Het
Medag	T	C	5: 149,422,217	V7A	probably benign	Het
Mptx2	G	A	1: 173,274,847	L92F	probably benign	Het
Nckap5	C	T	1: 125,976,925		probably null	Het
Obscn	T	C	11: 59,133,194	K550R	probably benign	Het
Olfr1369-ps1	T	A	13: 21,116,001	V103E	probably damaging	Het
Olfr193	T	A	16: 59,109,993	I206F	probably damaging	Het
Olfr716	A	G	7: 107,147,541	N75S	probably benign	Het
Olfr8	T	C	10: 78,955,484	I93T	probably damaging	Het
Parp6	T	C	9: 59,624,727	S101P	probably damaging	Het
Plcd3	T	C	11: 103,073,763	N594S	probably benign	Het
Plscr5	A	T	9: 92,205,511	K178*	probably null	Het
Ppp2r1b	T	C	9: 50,878,157	Y443H	probably damaging	Het
Pqlc2	C	T	4: 139,300,254	S259N	probably damaging	Het
Prnd	G	A	2: 131,953,343	V128I	probably benign	Het
Rftn1	G	T	17: 50,002,669	P156Q	probably damaging	Het
Scmh1	T	C	4: 120,516,946	V445A	probably benign	Het
Serpinb6c	A	T	13: 33,899,308	M41K	probably damaging	Het
Spns1	A	G	7: 126,372,469	V303A	possibly damaging	Het
Ston1	T	A	17: 88,644,339	S639R	probably damaging	Het
Thbs4	T	C	13: 92,776,953	D153G	probably benign	Het
Timm44	T	C	8: 4,274,171	Y36C	probably damaging	Het
Trim34b	G	T	7: 104,336,411	V418F	probably damaging	Het
Vmn1r72	C	T	7: 11,670,423	V33M	probably damaging	Het
Zcchc7	T	C	4: 44,931,084	V412A	probably benign	Het
Zfand1	T	A	3: 10,341,019	N210I	probably damaging	Het
Zfhx3	A	G	8: 108,933,867	H1251R	probably damaging	Het

Other mutations in Gm4884

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Gm4884	APN	7	41044385	missense	probably benign	0.22
IGL00980:Gm4884	APN	7	41043726	missense	probably damaging	1.00
IGL02230:Gm4884	APN	7	41043405	missense	probably damaging	1.00
IGL03271:Gm4884	APN	7	41043275	missense	probably benign	0.33
IGL03274:Gm4884	APN	7	41044545	missense	probably damaging	1.00
R0013:Gm4884	UTSW	7	41044292	missense	probably damaging	1.00
R0139:Gm4884	UTSW	7	41042963	missense	probably benign	0.00
R0179:Gm4884	UTSW	7	41043828	missense	probably benign	0.26
R0960:Gm4884	UTSW	7	41042808	missense	possibly damaging	0.55
R1167:Gm4884	UTSW	7	41043912	missense	possibly damaging	0.92
R1311:Gm4884	UTSW	7	41043115	missense	possibly damaging	0.73
R1466:Gm4884	UTSW	7	41043128	missense	probably damaging	0.96
R1466:Gm4884	UTSW	7	41043128	missense	probably damaging	0.96
R1581:Gm4884	UTSW	7	41043831	missense	probably benign	0.09
R1622:Gm4884	UTSW	7	41042841	missense	probably damaging	0.99
R1891:Gm4884	UTSW	7	41043115	missense	possibly damaging	0.73
R1952:Gm4884	UTSW	7	41044247	missense	probably benign	0.02
R2198:Gm4884	UTSW	7	41040805	missense	probably benign
R2209:Gm4884	UTSW	7	41043321	missense	possibly damaging	0.47
R2210:Gm4884	UTSW	7	41043546	missense	possibly damaging	0.72
R2219:Gm4884	UTSW	7	41043486	missense	possibly damaging	0.75
R3688:Gm4884	UTSW	7	41043486	missense	possibly damaging	0.75
R4437:Gm4884	UTSW	7	41043090	missense	probably damaging	0.97
R4472:Gm4884	UTSW	7	41043263	missense	probably benign	0.35
R5137:Gm4884	UTSW	7	41042894	missense	probably damaging	0.99
R5875:Gm4884	UTSW	7	41042936	missense	possibly damaging	0.75
R6479:Gm4884	UTSW	7	41040787	missense	probably damaging	0.99
R6659:Gm4884	UTSW	7	41044622	missense	probably damaging	1.00
R7180:Gm4884	UTSW	7	41044209	missense	possibly damaging	0.89
R7844:Gm4884	UTSW	7	41040698	missense	probably benign	0.11
R8153:Gm4884	UTSW	7	41043158	missense	probably benign	0.17
R8436:Gm4884	UTSW	7	41043386	missense	probably damaging	0.97
R8880:Gm4884	UTSW	7	41044487	missense	probably damaging	1.00
R8885:Gm4884	UTSW	7	41044684	nonsense	probably null
R9406:Gm4884	UTSW	7	41043141	missense	probably damaging	1.00
R9621:Gm4884	UTSW	7	41043687	missense	possibly damaging	0.76
R9728:Gm4884	UTSW	7	41043265	missense	probably benign	0.00
RF013:Gm4884	UTSW	7	41040809	missense	probably damaging	1.00
Z1088:Gm4884	UTSW	7	41042876	missense	possibly damaging	0.71
Z1177:Gm4884	UTSW	7	41032737	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- ACACACCAGTCCTGACTTTG -3'
(R):5'- GTCAATAGCCCTGTCACTGG -3'

Sequencing Primer
(F):5'- TTGGAACACCCTGACTTGCAG -3'
(R):5'- AATTTGGCCTGAGGAGCC -3'

Posted On

2017-01-03