Incidental Mutation 'R5700:Trim34b'
ID450845
Institutional Source Beutler Lab
Gene Symbol Trim34b
Ensembl Gene ENSMUSG00000090215
Gene Nametripartite motif-containing 34B
SynonymsTrim34-2, Gm15134
MMRRC Submission 043328-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #R5700 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104329471-104336909 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 104336411 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 418 (V418F)
Ref Sequence ENSEMBL: ENSMUSP00000136926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059037] [ENSMUST00000106847] [ENSMUST00000130139] [ENSMUST00000180136]
Predicted Effect probably benign
Transcript: ENSMUST00000059037
SMART Domains Protein: ENSMUSP00000060100
Gene: ENSMUSG00000057143

DomainStartEndE-ValueType
RING 15 58 5.51e-7 SMART
BBOX 91 132 4.83e-12 SMART
low complexity region 196 209 N/A INTRINSIC
Pfam:SPRY 351 493 8.7e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106847
AA Change: V418F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102460
Gene: ENSMUSG00000090215
AA Change: V418F

DomainStartEndE-ValueType
RING 15 58 7.8e-7 SMART
ZnF_RBZ 31 61 5.96e-1 SMART
BBOX 91 132 2.15e-9 SMART
low complexity region 195 209 N/A INTRINSIC
Blast:PRY 299 343 3e-21 BLAST
Pfam:SPRY 347 474 7.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130139
SMART Domains Protein: ENSMUSP00000116775
Gene: ENSMUSG00000057143

DomainStartEndE-ValueType
RING 15 58 5.51e-7 SMART
BBOX 91 132 4.83e-12 SMART
low complexity region 196 209 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178316
AA Change: V418F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136248
Gene: ENSMUSG00000090215
AA Change: V418F

DomainStartEndE-ValueType
RING 15 58 7.8e-7 SMART
ZnF_RBZ 31 61 5.96e-1 SMART
BBOX 91 132 2.15e-9 SMART
low complexity region 195 209 N/A INTRINSIC
Blast:PRY 299 343 3e-21 BLAST
Pfam:SPRY 345 484 3e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000180136
AA Change: V418F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136926
Gene: ENSMUSG00000090215
AA Change: V418F

DomainStartEndE-ValueType
RING 15 58 7.8e-7 SMART
ZnF_RBZ 31 61 5.96e-1 SMART
BBOX 91 132 2.15e-9 SMART
low complexity region 195 209 N/A INTRINSIC
Blast:PRY 299 343 2e-21 BLAST
Pfam:SPRY 345 484 3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184402
Meta Mutation Damage Score 0.2684 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,798,194 Q155L probably benign Het
Acadvl A C 11: 70,013,203 Y242D probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Barx2 A T 9: 31,858,765 F156I probably damaging Het
Best1 T C 19: 9,997,199 probably benign Het
Btbd8 T C 5: 107,503,648 S136P possibly damaging Het
Btla T A 16: 45,250,573 Y298* probably null Het
Casr T A 16: 36,509,617 I452F probably damaging Het
Ccser1 C A 6: 61,311,276 P141H probably benign Het
Cr2 A G 1: 195,159,757 V296A probably damaging Het
Csl T A 10: 99,759,015 I63F probably damaging Het
Dbt G A 3: 116,520,303 V40M probably damaging Het
Fam53b A T 7: 132,760,020 L93Q probably damaging Het
Fdps T C 3: 89,095,649 I105V probably damaging Het
Gm4884 A G 7: 41,043,219 D204G probably benign Het
Gm5592 A G 7: 41,158,579 probably benign Het
Gm7367 A T 7: 60,155,762 noncoding transcript Het
Grid2 T A 6: 64,094,432 V413D possibly damaging Het
Hgf C T 5: 16,610,124 P471L probably damaging Het
Hoxc9 T C 15: 102,981,881 Y77H possibly damaging Het
Hs6st3 C T 14: 119,138,787 R125* probably null Het
Kdm4b T C 17: 56,351,700 I15T possibly damaging Het
Klhl1 T C 14: 96,518,040 N93S probably benign Het
Klhl6 G A 16: 19,957,218 Q197* probably null Het
Medag T C 5: 149,422,217 V7A probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Nckap5 C T 1: 125,976,925 probably null Het
Obscn T C 11: 59,133,194 K550R probably benign Het
Olfr1369-ps1 T A 13: 21,116,001 V103E probably damaging Het
Olfr193 T A 16: 59,109,993 I206F probably damaging Het
Olfr716 A G 7: 107,147,541 N75S probably benign Het
Olfr8 T C 10: 78,955,484 I93T probably damaging Het
Parp6 T C 9: 59,624,727 S101P probably damaging Het
Plcd3 T C 11: 103,073,763 N594S probably benign Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Ppp2r1b T C 9: 50,878,157 Y443H probably damaging Het
Pqlc2 C T 4: 139,300,254 S259N probably damaging Het
Prnd G A 2: 131,953,343 V128I probably benign Het
Rftn1 G T 17: 50,002,669 P156Q probably damaging Het
Scmh1 T C 4: 120,516,946 V445A probably benign Het
Serpinb6c A T 13: 33,899,308 M41K probably damaging Het
Spns1 A G 7: 126,372,469 V303A possibly damaging Het
Ston1 T A 17: 88,644,339 S639R probably damaging Het
Thbs4 T C 13: 92,776,953 D153G probably benign Het
Timm44 T C 8: 4,274,171 Y36C probably damaging Het
Vmn1r72 C T 7: 11,670,423 V33M probably damaging Het
Zcchc7 T C 4: 44,931,084 V412A probably benign Het
Zfand1 T A 3: 10,341,019 N210I probably damaging Het
Zfhx3 A G 8: 108,933,867 H1251R probably damaging Het
Other mutations in Trim34b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Trim34b APN 7 104329652 nonsense probably null
IGL01103:Trim34b APN 7 104329899 missense probably damaging 1.00
IGL02252:Trim34b APN 7 104329932 missense probably damaging 0.98
IGL03241:Trim34b APN 7 104334613 intron probably benign
R0032:Trim34b UTSW 7 104336577 missense possibly damaging 0.61
R0381:Trim34b UTSW 7 104329855 missense probably damaging 1.00
R2403:Trim34b UTSW 7 104329669 missense probably benign
R2520:Trim34b UTSW 7 104331239 missense probably damaging 1.00
R2857:Trim34b UTSW 7 104336232 missense probably benign 0.00
R2859:Trim34b UTSW 7 104336232 missense probably benign 0.00
R3077:Trim34b UTSW 7 104331301 missense possibly damaging 0.89
R4094:Trim34b UTSW 7 104334588 missense probably benign
R4449:Trim34b UTSW 7 104335728 missense probably benign 0.00
R5183:Trim34b UTSW 7 104329911 missense possibly damaging 0.92
R5759:Trim34b UTSW 7 104331433 missense possibly damaging 0.46
R6236:Trim34b UTSW 7 104336318 missense probably damaging 0.99
R6364:Trim34b UTSW 7 104336526 missense probably damaging 0.99
R7034:Trim34b UTSW 7 104329536 start gained probably benign
R7036:Trim34b UTSW 7 104329536 start gained probably benign
R7237:Trim34b UTSW 7 104329587 missense possibly damaging 0.80
R7392:Trim34b UTSW 7 104336397 missense probably benign 0.00
R7405:Trim34b UTSW 7 104336483 missense probably damaging 1.00
R7516:Trim34b UTSW 7 104329711 missense probably damaging 1.00
R7646:Trim34b UTSW 7 104335352 missense probably damaging 0.97
R7909:Trim34b UTSW 7 104330524 missense probably benign 0.01
R8396:Trim34b UTSW 7 104329876 missense probably damaging 1.00
Z1176:Trim34b UTSW 7 104335314 missense probably damaging 1.00
Z1177:Trim34b UTSW 7 104331353 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TGTCTGAAAAGAATGCCTGGACC -3'
(R):5'- ACTCAGGAGTTCAGAGGACAC -3'

Sequencing Primer
(F):5'- GACCCTGGGAGTTTACACTAG -3'
(R):5'- TCATGGGGGCTGGACAGTC -3'
Posted On2017-01-03