Incidental Mutation 'R5700:Ppp2r1b'
ID450852
Institutional Source Beutler Lab
Gene Symbol Ppp2r1b
Ensembl Gene ENSMUSG00000032058
Gene Nameprotein phosphatase 2, regulatory subunit A, beta
Synonyms2410091N08Rik
MMRRC Submission 043328-MU
Accession Numbers

Ncbi RefSeq: NM_001034085.1, NM_028614.2; MGI:1920949

Is this an essential gene? Possibly essential (E-score: 0.646) question?
Stock #R5700 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location50845301-50894229 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50878157 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 443 (Y443H)
Ref Sequence ENSEMBL: ENSMUSP00000135758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034560] [ENSMUST00000114437] [ENSMUST00000174628] [ENSMUST00000175640] [ENSMUST00000175645] [ENSMUST00000175926] [ENSMUST00000176055] [ENSMUST00000176349] [ENSMUST00000176798]
Predicted Effect probably damaging
Transcript: ENSMUST00000034560
AA Change: Y507H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034560
Gene: ENSMUSG00000032058
AA Change: Y507H

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:HEAT 178 208 2.2e-6 PFAM
Pfam:HEAT_EZ 182 243 9.9e-6 PFAM
Pfam:HEAT 295 325 5.9e-6 PFAM
Pfam:HEAT_2 378 479 1.1e-10 PFAM
Pfam:HEAT_2 495 596 5.1e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114437
AA Change: Y507H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110080
Gene: ENSMUSG00000032058
AA Change: Y507H

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:HEAT 178 208 1.6e-6 PFAM
Pfam:HEAT_EZ 180 243 7.3e-6 PFAM
Pfam:HEAT 217 247 4.3e-5 PFAM
Pfam:HEAT 295 325 4.2e-6 PFAM
Pfam:HEAT_2 378 479 9e-11 PFAM
Pfam:HEAT_2 494 597 4.2e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174628
AA Change: Y507H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133404
Gene: ENSMUSG00000032058
AA Change: Y507H

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:HEAT 178 208 4.6e-6 PFAM
Pfam:HEAT 217 247 4.5e-5 PFAM
Pfam:HEAT 295 325 4.3e-6 PFAM
Pfam:HEAT_2 378 479 1.7e-11 PFAM
low complexity region 643 655 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000175640
AA Change: Y380H

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134740
Gene: ENSMUSG00000032058
AA Change: Y380H

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:HEAT 129 159 5.7e-5 PFAM
Pfam:HEAT 168 198 4e-6 PFAM
Pfam:HEAT_2 251 352 6.3e-11 PFAM
Pfam:HEAT_2 365 470 3e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000175645
AA Change: Y462H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135871
Gene: ENSMUSG00000032058
AA Change: Y462H

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:HEAT_EZ 173 243 8e-6 PFAM
Pfam:HEAT 178 208 1.8e-6 PFAM
Pfam:HEAT 217 247 4.9e-5 PFAM
Pfam:HEAT 295 325 4.8e-6 PFAM
Pfam:HEAT_2 449 552 3.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175926
SMART Domains Protein: ENSMUSP00000134886
Gene: ENSMUSG00000032058

DomainStartEndE-ValueType
SCOP:d1b3ua_ 14 104 4e-15 SMART
PDB:3DW8|D 22 104 4e-45 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000176055
SMART Domains Protein: ENSMUSP00000135253
Gene: ENSMUSG00000032058

DomainStartEndE-ValueType
PDB:3DW8|D 1 51 1e-26 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000176349
AA Change: Y443H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135758
Gene: ENSMUSG00000032058
AA Change: Y443H

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:HEAT 114 144 2e-6 PFAM
Pfam:HEAT_EZ 116 179 8.7e-6 PFAM
Pfam:HEAT 153 183 5.5e-5 PFAM
Pfam:HEAT 231 261 5.3e-6 PFAM
Pfam:HEAT_2 314 415 9.3e-11 PFAM
Pfam:HEAT_2 430 532 4.4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176414
Predicted Effect probably damaging
Transcript: ENSMUST00000176798
AA Change: Y507H

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135525
Gene: ENSMUSG00000032058
AA Change: Y507H

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:HEAT 178 208 2.3e-6 PFAM
Pfam:HEAT_EZ 182 243 1e-5 PFAM
Pfam:HEAT 295 325 6e-6 PFAM
Pfam:HEAT_2 378 479 1.1e-10 PFAM
Pfam:HEAT_2 495 596 5.2e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177454
Meta Mutation Damage Score 0.5589 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a constant regulatory subunit of protein phosphatase 2. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The constant regulatory subunit A serves as a scaffolding molecule to coordinate the assembly of the catalytic subunit and a variable regulatory B subunit. This gene encodes a beta isoform of the constant regulatory subunit A. Mutations in this gene have been associated with some lung and colon cancers. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,798,194 Q155L probably benign Het
Acadvl A C 11: 70,013,203 Y242D probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Barx2 A T 9: 31,858,765 F156I probably damaging Het
Best1 T C 19: 9,997,199 probably benign Het
Btbd8 T C 5: 107,503,648 S136P possibly damaging Het
Btla T A 16: 45,250,573 Y298* probably null Het
Casr T A 16: 36,509,617 I452F probably damaging Het
Ccser1 C A 6: 61,311,276 P141H probably benign Het
Cr2 A G 1: 195,159,757 V296A probably damaging Het
Csl T A 10: 99,759,015 I63F probably damaging Het
Dbt G A 3: 116,520,303 V40M probably damaging Het
Fam53b A T 7: 132,760,020 L93Q probably damaging Het
Fdps T C 3: 89,095,649 I105V probably damaging Het
Gm4884 A G 7: 41,043,219 D204G probably benign Het
Gm5592 A G 7: 41,158,579 probably benign Het
Gm7367 A T 7: 60,155,762 noncoding transcript Het
Grid2 T A 6: 64,094,432 V413D possibly damaging Het
Hgf C T 5: 16,610,124 P471L probably damaging Het
Hoxc9 T C 15: 102,981,881 Y77H possibly damaging Het
Hs6st3 C T 14: 119,138,787 R125* probably null Het
Kdm4b T C 17: 56,351,700 I15T possibly damaging Het
Klhl1 T C 14: 96,518,040 N93S probably benign Het
Klhl6 G A 16: 19,957,218 Q197* probably null Het
Medag T C 5: 149,422,217 V7A probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Nckap5 C T 1: 125,976,925 probably null Het
Obscn T C 11: 59,133,194 K550R probably benign Het
Olfr1369-ps1 T A 13: 21,116,001 V103E probably damaging Het
Olfr193 T A 16: 59,109,993 I206F probably damaging Het
Olfr716 A G 7: 107,147,541 N75S probably benign Het
Olfr8 T C 10: 78,955,484 I93T probably damaging Het
Parp6 T C 9: 59,624,727 S101P probably damaging Het
Plcd3 T C 11: 103,073,763 N594S probably benign Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Pqlc2 C T 4: 139,300,254 S259N probably damaging Het
Prnd G A 2: 131,953,343 V128I probably benign Het
Rftn1 G T 17: 50,002,669 P156Q probably damaging Het
Scmh1 T C 4: 120,516,946 V445A probably benign Het
Serpinb6c A T 13: 33,899,308 M41K probably damaging Het
Spns1 A G 7: 126,372,469 V303A possibly damaging Het
Ston1 T A 17: 88,644,339 S639R probably damaging Het
Thbs4 T C 13: 92,776,953 D153G probably benign Het
Timm44 T C 8: 4,274,171 Y36C probably damaging Het
Trim34b G T 7: 104,336,411 V418F probably damaging Het
Vmn1r72 C T 7: 11,670,423 V33M probably damaging Het
Zcchc7 T C 4: 44,931,084 V412A probably benign Het
Zfand1 T A 3: 10,341,019 N210I probably damaging Het
Zfhx3 A G 8: 108,933,867 H1251R probably damaging Het
Other mutations in Ppp2r1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Ppp2r1b APN 9 50878122 missense probably damaging 0.99
IGL01623:Ppp2r1b APN 9 50878122 missense probably damaging 0.99
IGL02120:Ppp2r1b APN 9 50861769 splice site probably benign
IGL02158:Ppp2r1b APN 9 50861609 missense probably benign 0.02
IGL02706:Ppp2r1b APN 9 50878834 missense possibly damaging 0.83
IGL02801:Ppp2r1b APN 9 50878827 missense probably benign 0.00
IGL02943:Ppp2r1b APN 9 50883585 missense probably damaging 1.00
R0047:Ppp2r1b UTSW 9 50861573 nonsense probably null
R0047:Ppp2r1b UTSW 9 50861573 nonsense probably null
R0211:Ppp2r1b UTSW 9 50861625 missense probably benign 0.00
R0603:Ppp2r1b UTSW 9 50861685 missense probably damaging 1.00
R1219:Ppp2r1b UTSW 9 50867321 splice site probably benign
R1513:Ppp2r1b UTSW 9 50870145 missense probably damaging 1.00
R1545:Ppp2r1b UTSW 9 50862425 missense possibly damaging 0.68
R1997:Ppp2r1b UTSW 9 50867371 missense possibly damaging 0.71
R1998:Ppp2r1b UTSW 9 50883585 missense probably damaging 1.00
R2153:Ppp2r1b UTSW 9 50866554 missense probably damaging 1.00
R3829:Ppp2r1b UTSW 9 50862494 missense probably benign 0.02
R4672:Ppp2r1b UTSW 9 50867719 missense probably damaging 0.99
R5299:Ppp2r1b UTSW 9 50857040 missense probably benign 0.04
R5376:Ppp2r1b UTSW 9 50866928 missense possibly damaging 0.78
R5504:Ppp2r1b UTSW 9 50858887 missense probably damaging 1.00
R5771:Ppp2r1b UTSW 9 50866832 missense probably damaging 0.98
R7547:Ppp2r1b UTSW 9 50862462 missense probably benign 0.06
R7626:Ppp2r1b UTSW 9 50878176 missense possibly damaging 0.91
Z1088:Ppp2r1b UTSW 9 50866911 missense probably damaging 1.00
Z1176:Ppp2r1b UTSW 9 50873645 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TACAGTAGGCTTGCCCAGAG -3'
(R):5'- TGACACTGAGCCATCTCTCC -3'

Sequencing Primer
(F):5'- AGGCTTGCCCAGAGTTTGTTTTG -3'
(R):5'- TCTCTCCAGCTCCAAAATTTTAAATC -3'
Posted On2017-01-03