Incidental Mutation 'R5700:Plscr5'
ID450854
Institutional Source Beutler Lab
Gene Symbol Plscr5
Ensembl Gene ENSMUSG00000095654
Gene Namephospholipid scramblase family, member 5
Synonyms
MMRRC Submission 043328-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R5700 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location92192936-92209772 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 92205511 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 178 (K178*)
Ref Sequence ENSEMBL: ENSMUSP00000136181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179751]
Predicted Effect probably null
Transcript: ENSMUST00000179751
AA Change: K178*
SMART Domains Protein: ENSMUSP00000136181
Gene: ENSMUSG00000095654
AA Change: K178*

DomainStartEndE-ValueType
Pfam:Scramblase 47 269 1.5e-79 PFAM
Meta Mutation Damage Score 0.9716 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,798,194 Q155L probably benign Het
Acadvl A C 11: 70,013,203 Y242D probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Barx2 A T 9: 31,858,765 F156I probably damaging Het
Best1 T C 19: 9,997,199 probably benign Het
Btbd8 T C 5: 107,503,648 S136P possibly damaging Het
Btla T A 16: 45,250,573 Y298* probably null Het
Casr T A 16: 36,509,617 I452F probably damaging Het
Ccser1 C A 6: 61,311,276 P141H probably benign Het
Cr2 A G 1: 195,159,757 V296A probably damaging Het
Csl T A 10: 99,759,015 I63F probably damaging Het
Dbt G A 3: 116,520,303 V40M probably damaging Het
Fam53b A T 7: 132,760,020 L93Q probably damaging Het
Fdps T C 3: 89,095,649 I105V probably damaging Het
Gm4884 A G 7: 41,043,219 D204G probably benign Het
Gm5592 A G 7: 41,158,579 probably benign Het
Gm7367 A T 7: 60,155,762 noncoding transcript Het
Grid2 T A 6: 64,094,432 V413D possibly damaging Het
Hgf C T 5: 16,610,124 P471L probably damaging Het
Hoxc9 T C 15: 102,981,881 Y77H possibly damaging Het
Hs6st3 C T 14: 119,138,787 R125* probably null Het
Kdm4b T C 17: 56,351,700 I15T possibly damaging Het
Klhl1 T C 14: 96,518,040 N93S probably benign Het
Klhl6 G A 16: 19,957,218 Q197* probably null Het
Medag T C 5: 149,422,217 V7A probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Nckap5 C T 1: 125,976,925 probably null Het
Obscn T C 11: 59,133,194 K550R probably benign Het
Olfr1369-ps1 T A 13: 21,116,001 V103E probably damaging Het
Olfr193 T A 16: 59,109,993 I206F probably damaging Het
Olfr716 A G 7: 107,147,541 N75S probably benign Het
Olfr8 T C 10: 78,955,484 I93T probably damaging Het
Parp6 T C 9: 59,624,727 S101P probably damaging Het
Plcd3 T C 11: 103,073,763 N594S probably benign Het
Ppp2r1b T C 9: 50,878,157 Y443H probably damaging Het
Pqlc2 C T 4: 139,300,254 S259N probably damaging Het
Prnd G A 2: 131,953,343 V128I probably benign Het
Rftn1 G T 17: 50,002,669 P156Q probably damaging Het
Scmh1 T C 4: 120,516,946 V445A probably benign Het
Serpinb6c A T 13: 33,899,308 M41K probably damaging Het
Spns1 A G 7: 126,372,469 V303A possibly damaging Het
Ston1 T A 17: 88,644,339 S639R probably damaging Het
Thbs4 T C 13: 92,776,953 D153G probably benign Het
Timm44 T C 8: 4,274,171 Y36C probably damaging Het
Trim34b G T 7: 104,336,411 V418F probably damaging Het
Vmn1r72 C T 7: 11,670,423 V33M probably damaging Het
Zcchc7 T C 4: 44,931,084 V412A probably benign Het
Zfand1 T A 3: 10,341,019 N210I probably damaging Het
Zfhx3 A G 8: 108,933,867 H1251R probably damaging Het
Other mutations in Plscr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
rambler UTSW 9 92198598 missense probably benign
scrambler UTSW 9 92205511 nonsense probably null
R1710:Plscr5 UTSW 9 92205528 missense probably damaging 1.00
R2157:Plscr5 UTSW 9 92198497 missense probably benign
R4190:Plscr5 UTSW 9 92198598 missense probably benign
R5093:Plscr5 UTSW 9 92198521 missense probably benign 0.00
R5308:Plscr5 UTSW 9 92198512 missense possibly damaging 0.63
R5639:Plscr5 UTSW 9 92205511 nonsense probably null
R5693:Plscr5 UTSW 9 92205511 nonsense probably null
R5694:Plscr5 UTSW 9 92205511 nonsense probably null
R5701:Plscr5 UTSW 9 92205511 nonsense probably null
R6009:Plscr5 UTSW 9 92204435 nonsense probably null
R6091:Plscr5 UTSW 9 92204384 missense probably benign 0.15
R6303:Plscr5 UTSW 9 92205556 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CAGAAGAAAATACTGCTTTGCATCC -3'
(R):5'- GACTTAGAATCTCTGGAGTGATGG -3'

Sequencing Primer
(F):5'- AATACTGCTTTGCATCCTAGAAAC -3'
(R):5'- AAGGGGTACATTATGATCTTGATGAC -3'
Posted On2017-01-03