Mutagenetix > Incidental Mutation

Incidental Mutation 'R5700:Armc8'

450855

Institutional Source

Beutler Lab

Gene Symbol

Armc8

Ensembl Gene

ENSMUSG00000032468

Gene Name

armadillo repeat containing 8

Synonyms

1200015K23Rik, HSPC056, Gid5

MMRRC Submission

043328-MU

Accession Numbers

Genbank: NM_028768; MGI: 1921375

Essential gene?

Possibly essential (E-score: 0.746) question?

Stock #

R5700 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99478372-99568899 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 99496149 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000035043 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035043]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000035043

SMART Domains

Protein: ENSMUSP00000035043
Gene: ENSMUSG00000032468

Domain	Start	End	E-Value	Type
ARM	50	92	1.75e0	SMART
ARM	94	134	5.34e0	SMART
ARM	177	217	2.04e1	SMART
ARM	372	413	3.58e1	SMART
Blast:ARM	414	455	7e-17	BLAST
ARM	457	497	3.81e-1	SMART
ARM	500	540	5.43e1	SMART
Blast:ARM	542	585	1e-20	BLAST
Blast:ARM	633	673	1e-16	BLAST

Meta Mutation Damage Score

0.9499

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

98% (50/51)

Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc2	A	T	19: 43,798,194	Q155L	probably benign	Het
Acadvl	A	C	11: 70,013,203	Y242D	probably damaging	Het
Barx2	A	T	9: 31,858,765	F156I	probably damaging	Het
Best1	T	C	19: 9,997,199		probably benign	Het
Btbd8	T	C	5: 107,503,648	S136P	possibly damaging	Het
Btla	T	A	16: 45,250,573	Y298*	probably null	Het
Casr	T	A	16: 36,509,617	I452F	probably damaging	Het
Ccser1	C	A	6: 61,311,276	P141H	probably benign	Het
Cr2	A	G	1: 195,159,757	V296A	probably damaging	Het
Csl	T	A	10: 99,759,015	I63F	probably damaging	Het
Dbt	G	A	3: 116,520,303	V40M	probably damaging	Het
Fam53b	A	T	7: 132,760,020	L93Q	probably damaging	Het
Fdps	T	C	3: 89,095,649	I105V	probably damaging	Het
Gm4884	A	G	7: 41,043,219	D204G	probably benign	Het
Gm5592	A	G	7: 41,158,579		probably benign	Het
Gm7367	A	T	7: 60,155,762		noncoding transcript	Het
Grid2	T	A	6: 64,094,432	V413D	possibly damaging	Het
Hgf	C	T	5: 16,610,124	P471L	probably damaging	Het
Hoxc9	T	C	15: 102,981,881	Y77H	possibly damaging	Het
Hs6st3	C	T	14: 119,138,787	R125*	probably null	Het
Kdm4b	T	C	17: 56,351,700	I15T	possibly damaging	Het
Klhl1	T	C	14: 96,518,040	N93S	probably benign	Het
Klhl6	G	A	16: 19,957,218	Q197*	probably null	Het
Medag	T	C	5: 149,422,217	V7A	probably benign	Het
Mptx2	G	A	1: 173,274,847	L92F	probably benign	Het
Nckap5	C	T	1: 125,976,925		probably null	Het
Obscn	T	C	11: 59,133,194	K550R	probably benign	Het
Olfr1369-ps1	T	A	13: 21,116,001	V103E	probably damaging	Het
Olfr193	T	A	16: 59,109,993	I206F	probably damaging	Het
Olfr716	A	G	7: 107,147,541	N75S	probably benign	Het
Olfr8	T	C	10: 78,955,484	I93T	probably damaging	Het
Parp6	T	C	9: 59,624,727	S101P	probably damaging	Het
Plcd3	T	C	11: 103,073,763	N594S	probably benign	Het
Plscr5	A	T	9: 92,205,511	K178*	probably null	Het
Ppp2r1b	T	C	9: 50,878,157	Y443H	probably damaging	Het
Pqlc2	C	T	4: 139,300,254	S259N	probably damaging	Het
Prnd	G	A	2: 131,953,343	V128I	probably benign	Het
Rftn1	G	T	17: 50,002,669	P156Q	probably damaging	Het
Scmh1	T	C	4: 120,516,946	V445A	probably benign	Het
Serpinb6c	A	T	13: 33,899,308	M41K	probably damaging	Het
Spns1	A	G	7: 126,372,469	V303A	possibly damaging	Het
Ston1	T	A	17: 88,644,339	S639R	probably damaging	Het
Thbs4	T	C	13: 92,776,953	D153G	probably benign	Het
Timm44	T	C	8: 4,274,171	Y36C	probably damaging	Het
Trim34b	G	T	7: 104,336,411	V418F	probably damaging	Het
Vmn1r72	C	T	7: 11,670,423	V33M	probably damaging	Het
Zcchc7	T	C	4: 44,931,084	V412A	probably benign	Het
Zfand1	T	A	3: 10,341,019	N210I	probably damaging	Het
Zfhx3	A	G	8: 108,933,867	H1251R	probably damaging	Het

Other mutations in Armc8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Armc8	APN	9	99505734	critical splice acceptor site	probably null
IGL00951:Armc8	APN	9	99505704	missense	probably benign	0.00
IGL01776:Armc8	APN	9	99526883	splice site	probably benign
IGL02215:Armc8	APN	9	99483978	missense	possibly damaging	0.92
IGL02244:Armc8	APN	9	99483174	missense	probably benign	0.10
IGL02610:Armc8	APN	9	99527069	splice site	probably benign
IGL02612:Armc8	APN	9	99527069	splice site	probably benign
IGL02615:Armc8	APN	9	99527069	splice site	probably benign
IGL02619:Armc8	APN	9	99527069	splice site	probably benign
IGL02621:Armc8	APN	9	99527069	splice site	probably benign
IGL02622:Armc8	APN	9	99527069	splice site	probably benign
IGL02623:Armc8	APN	9	99527069	splice site	probably benign
IGL02624:Armc8	APN	9	99527069	splice site	probably benign
Scrambler	UTSW	9	99496149	critical splice donor site	probably null
warthog	UTSW	9	99520485	missense	probably benign	0.02
D4043:Armc8	UTSW	9	99483976	missense	probably benign	0.13
R0321:Armc8	UTSW	9	99533177	missense	probably damaging	0.99
R0498:Armc8	UTSW	9	99497292	missense	probably damaging	1.00
R0646:Armc8	UTSW	9	99505688	missense	probably damaging	1.00
R0658:Armc8	UTSW	9	99536158	splice site	probably benign
R1061:Armc8	UTSW	9	99537731	missense	probably damaging	1.00
R1406:Armc8	UTSW	9	99523248	missense	probably benign	0.37
R1406:Armc8	UTSW	9	99523248	missense	probably benign	0.37
R1429:Armc8	UTSW	9	99536207	missense	possibly damaging	0.67
R1432:Armc8	UTSW	9	99523132	splice site	probably benign
R1538:Armc8	UTSW	9	99505290	missense	probably damaging	0.96
R1606:Armc8	UTSW	9	99537729	missense	probably damaging	0.98
R1817:Armc8	UTSW	9	99536259	missense	possibly damaging	0.67
R1866:Armc8	UTSW	9	99536280	missense	probably benign
R2015:Armc8	UTSW	9	99483105	nonsense	probably null
R2143:Armc8	UTSW	9	99505308	missense	probably damaging	0.99
R2251:Armc8	UTSW	9	99502600	critical splice acceptor site	probably null
R2842:Armc8	UTSW	9	99505681	missense	probably benign
R3010:Armc8	UTSW	9	99487913	missense	probably benign	0.06
R3709:Armc8	UTSW	9	99520497	missense	probably damaging	1.00
R4440:Armc8	UTSW	9	99484034	missense	probably benign	0.37
R4865:Armc8	UTSW	9	99526889	critical splice donor site	probably null
R5492:Armc8	UTSW	9	99527131	nonsense	probably null
R5606:Armc8	UTSW	9	99536262	missense	probably benign	0.23
R5639:Armc8	UTSW	9	99496149	critical splice donor site	probably null
R5693:Armc8	UTSW	9	99496149	critical splice donor site	probably null
R5694:Armc8	UTSW	9	99496149	critical splice donor site	probably null
R5698:Armc8	UTSW	9	99535820	missense	probably benign	0.12
R5701:Armc8	UTSW	9	99496149	critical splice donor site	probably null
R5735:Armc8	UTSW	9	99497394	critical splice acceptor site	probably null
R6314:Armc8	UTSW	9	99535884	missense	probably benign	0.28
R7034:Armc8	UTSW	9	99483965	critical splice donor site	probably null
R7036:Armc8	UTSW	9	99483965	critical splice donor site	probably null
R7393:Armc8	UTSW	9	99483999	missense	possibly damaging	0.47
R7395:Armc8	UTSW	9	99533132	missense	probably damaging	0.99
R7937:Armc8	UTSW	9	99536219	missense	probably damaging	0.98
R8130:Armc8	UTSW	9	99551547	missense	probably benign	0.02
R8373:Armc8	UTSW	9	99527099	missense	probably benign	0.02
R8734:Armc8	UTSW	9	99520485	missense	probably benign	0.02
R9098:Armc8	UTSW	9	99505309	nonsense	probably null
R9255:Armc8	UTSW	9	99497388	missense	possibly damaging	0.95
R9358:Armc8	UTSW	9	99568600	critical splice donor site	probably null
R9463:Armc8	UTSW	9	99496150	critical splice donor site	probably null
Z1177:Armc8	UTSW	9	99497386	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGCAGAGATGGGTCAGTACATG -3'
(R):5'- TCTTGATCAGCTGCATGAGAC -3'

Sequencing Primer
(F):5'- AGATGGGTCAGTACATGTGGCATG -3'
(R):5'- GATCAGCTGCATGAGACCCTCTC -3'

Posted On

2017-01-03