Incidental Mutation 'R5700:Csl'
ID450857
Institutional Source Beutler Lab
Gene Symbol Csl
Ensembl Gene ENSMUSG00000046934
Gene Namecitrate synthase like
Synonyms
MMRRC Submission 043328-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.566) question?
Stock #R5700 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location99757706-99759658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99759015 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 63 (I63F)
Ref Sequence ENSEMBL: ENSMUSP00000052373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056085]
PDB Structure Substrate induced remodeling of the active site regulates HtrA1 activity [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000056085
AA Change: I63F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000052373
Gene: ENSMUSG00000046934
AA Change: I63F

DomainStartEndE-ValueType
Pfam:Citrate_synt 71 449 6.2e-119 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222959
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,798,194 Q155L probably benign Het
Acadvl A C 11: 70,013,203 Y242D probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Barx2 A T 9: 31,858,765 F156I probably damaging Het
Best1 T C 19: 9,997,199 probably benign Het
Btbd8 T C 5: 107,503,648 S136P possibly damaging Het
Btla T A 16: 45,250,573 Y298* probably null Het
Casr T A 16: 36,509,617 I452F probably damaging Het
Ccser1 C A 6: 61,311,276 P141H probably benign Het
Cr2 A G 1: 195,159,757 V296A probably damaging Het
Dbt G A 3: 116,520,303 V40M probably damaging Het
Fam53b A T 7: 132,760,020 L93Q probably damaging Het
Fdps T C 3: 89,095,649 I105V probably damaging Het
Gm4884 A G 7: 41,043,219 D204G probably benign Het
Gm5592 A G 7: 41,158,579 probably benign Het
Gm7367 A T 7: 60,155,762 noncoding transcript Het
Grid2 T A 6: 64,094,432 V413D possibly damaging Het
Hgf C T 5: 16,610,124 P471L probably damaging Het
Hoxc9 T C 15: 102,981,881 Y77H possibly damaging Het
Hs6st3 C T 14: 119,138,787 R125* probably null Het
Kdm4b T C 17: 56,351,700 I15T possibly damaging Het
Klhl1 T C 14: 96,518,040 N93S probably benign Het
Klhl6 G A 16: 19,957,218 Q197* probably null Het
Medag T C 5: 149,422,217 V7A probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Nckap5 C T 1: 125,976,925 probably null Het
Obscn T C 11: 59,133,194 K550R probably benign Het
Olfr1369-ps1 T A 13: 21,116,001 V103E probably damaging Het
Olfr193 T A 16: 59,109,993 I206F probably damaging Het
Olfr716 A G 7: 107,147,541 N75S probably benign Het
Olfr8 T C 10: 78,955,484 I93T probably damaging Het
Parp6 T C 9: 59,624,727 S101P probably damaging Het
Plcd3 T C 11: 103,073,763 N594S probably benign Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Ppp2r1b T C 9: 50,878,157 Y443H probably damaging Het
Pqlc2 C T 4: 139,300,254 S259N probably damaging Het
Prnd G A 2: 131,953,343 V128I probably benign Het
Rftn1 G T 17: 50,002,669 P156Q probably damaging Het
Scmh1 T C 4: 120,516,946 V445A probably benign Het
Serpinb6c A T 13: 33,899,308 M41K probably damaging Het
Spns1 A G 7: 126,372,469 V303A possibly damaging Het
Ston1 T A 17: 88,644,339 S639R probably damaging Het
Thbs4 T C 13: 92,776,953 D153G probably benign Het
Timm44 T C 8: 4,274,171 Y36C probably damaging Het
Trim34b G T 7: 104,336,411 V418F probably damaging Het
Vmn1r72 C T 7: 11,670,423 V33M probably damaging Het
Zcchc7 T C 4: 44,931,084 V412A probably benign Het
Zfand1 T A 3: 10,341,019 N210I probably damaging Het
Zfhx3 A G 8: 108,933,867 H1251R probably damaging Het
Other mutations in Csl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02523:Csl APN 10 99758813 missense probably benign 0.39
R1519:Csl UTSW 10 99757955 missense probably damaging 1.00
R2284:Csl UTSW 10 99758459 missense possibly damaging 0.84
R2882:Csl UTSW 10 99758925 missense probably damaging 1.00
R4128:Csl UTSW 10 99758600 missense probably benign 0.02
R4424:Csl UTSW 10 99758591 missense possibly damaging 0.82
R4819:Csl UTSW 10 99758082 missense possibly damaging 0.81
R4876:Csl UTSW 10 99758540 missense possibly damaging 0.93
R6463:Csl UTSW 10 99759098 missense probably damaging 0.99
R8064:Csl UTSW 10 99758545 missense probably damaging 1.00
R8161:Csl UTSW 10 99758320 missense probably damaging 1.00
R8296:Csl UTSW 10 99758299 missense probably damaging 1.00
R8317:Csl UTSW 10 99759038 missense probably damaging 1.00
R8696:Csl UTSW 10 99758964 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATACCTGTTCCTCTGTGGG -3'
(R):5'- ATGGCTCTACTTACTGCGGC -3'

Sequencing Primer
(F):5'- GCATCTGTCCAGTTACCAGCAG -3'
(R):5'- TACTTACTGCGGCAGCCTG -3'
Posted On2017-01-03