Incidental Mutation 'R5700:Hoxc9'
ID 450866
Institutional Source Beutler Lab
Gene Symbol Hoxc9
Ensembl Gene ENSMUSG00000036139
Gene Name homeobox C9
Synonyms Hox-3.2
MMRRC Submission 043328-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5700 (G1)
Quality Score 207
Status Validated
Chromosome 15
Chromosomal Location 102976439-102985099 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 102981881 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 77 (Y77H)
Ref Sequence ENSEMBL: ENSMUSP00000001706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001706] [ENSMUST00000173306]
AlphaFold P09633
Predicted Effect possibly damaging
Transcript: ENSMUST00000001706
AA Change: Y77H

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000001706
Gene: ENSMUSG00000036139
AA Change: Y77H

DomainStartEndE-ValueType
Pfam:Hox9_act 1 179 2e-63 PFAM
HOX 192 254 8.84e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173306
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174869
Meta Mutation Damage Score 0.5199 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXC genes located in a cluster on chromosome 12. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene grow more slowly than normal and develop hunched backs. Forward transformations seen in vertebrae from L1 and forward to around T10. Abnormalities in the sternum and ribs attachments to the sternum are also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,798,194 Q155L probably benign Het
Acadvl A C 11: 70,013,203 Y242D probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Barx2 A T 9: 31,858,765 F156I probably damaging Het
Best1 T C 19: 9,997,199 probably benign Het
Btbd8 T C 5: 107,503,648 S136P possibly damaging Het
Btla T A 16: 45,250,573 Y298* probably null Het
Casr T A 16: 36,509,617 I452F probably damaging Het
Ccser1 C A 6: 61,311,276 P141H probably benign Het
Cr2 A G 1: 195,159,757 V296A probably damaging Het
Csl T A 10: 99,759,015 I63F probably damaging Het
Dbt G A 3: 116,520,303 V40M probably damaging Het
Fam53b A T 7: 132,760,020 L93Q probably damaging Het
Fdps T C 3: 89,095,649 I105V probably damaging Het
Gm4884 A G 7: 41,043,219 D204G probably benign Het
Gm5592 A G 7: 41,158,579 probably benign Het
Gm7367 A T 7: 60,155,762 noncoding transcript Het
Grid2 T A 6: 64,094,432 V413D possibly damaging Het
Hgf C T 5: 16,610,124 P471L probably damaging Het
Hs6st3 C T 14: 119,138,787 R125* probably null Het
Kdm4b T C 17: 56,351,700 I15T possibly damaging Het
Klhl1 T C 14: 96,518,040 N93S probably benign Het
Klhl6 G A 16: 19,957,218 Q197* probably null Het
Medag T C 5: 149,422,217 V7A probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Nckap5 C T 1: 125,976,925 probably null Het
Obscn T C 11: 59,133,194 K550R probably benign Het
Olfr1369-ps1 T A 13: 21,116,001 V103E probably damaging Het
Olfr193 T A 16: 59,109,993 I206F probably damaging Het
Olfr716 A G 7: 107,147,541 N75S probably benign Het
Olfr8 T C 10: 78,955,484 I93T probably damaging Het
Parp6 T C 9: 59,624,727 S101P probably damaging Het
Plcd3 T C 11: 103,073,763 N594S probably benign Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Ppp2r1b T C 9: 50,878,157 Y443H probably damaging Het
Pqlc2 C T 4: 139,300,254 S259N probably damaging Het
Prnd G A 2: 131,953,343 V128I probably benign Het
Rftn1 G T 17: 50,002,669 P156Q probably damaging Het
Scmh1 T C 4: 120,516,946 V445A probably benign Het
Serpinb6c A T 13: 33,899,308 M41K probably damaging Het
Spns1 A G 7: 126,372,469 V303A possibly damaging Het
Ston1 T A 17: 88,644,339 S639R probably damaging Het
Thbs4 T C 13: 92,776,953 D153G probably benign Het
Timm44 T C 8: 4,274,171 Y36C probably damaging Het
Trim34b G T 7: 104,336,411 V418F probably damaging Het
Vmn1r72 C T 7: 11,670,423 V33M probably damaging Het
Zcchc7 T C 4: 44,931,084 V412A probably benign Het
Zfand1 T A 3: 10,341,019 N210I probably damaging Het
Zfhx3 A G 8: 108,933,867 H1251R probably damaging Het
Other mutations in Hoxc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Hoxc9 APN 15 102984000 missense probably damaging 1.00
IGL01418:Hoxc9 APN 15 102984000 missense probably damaging 1.00
IGL03031:Hoxc9 APN 15 102984090 missense probably damaging 1.00
R0498:Hoxc9 UTSW 15 102983927 missense probably damaging 1.00
R1436:Hoxc9 UTSW 15 102981872 missense probably benign 0.03
R2059:Hoxc9 UTSW 15 102984123 missense probably benign 0.01
R2414:Hoxc9 UTSW 15 102984108 missense probably damaging 1.00
R2900:Hoxc9 UTSW 15 102981753 missense probably benign 0.00
R3807:Hoxc9 UTSW 15 102981684 missense possibly damaging 0.94
R3821:Hoxc9 UTSW 15 102982164 missense probably benign 0.32
R4824:Hoxc9 UTSW 15 102981793 nonsense probably null
R5165:Hoxc9 UTSW 15 102984000 missense probably damaging 1.00
R5701:Hoxc9 UTSW 15 102981881 missense possibly damaging 0.65
R6003:Hoxc9 UTSW 15 102981879 missense probably benign 0.15
R6145:Hoxc9 UTSW 15 102983959 missense probably damaging 1.00
R6570:Hoxc9 UTSW 15 102981753 missense probably benign 0.00
R7312:Hoxc9 UTSW 15 102982161 missense probably benign 0.02
R7434:Hoxc9 UTSW 15 102983982 missense probably damaging 1.00
R8080:Hoxc9 UTSW 15 102982119 missense probably benign 0.22
R8519:Hoxc9 UTSW 15 102983909 missense probably damaging 1.00
R8792:Hoxc9 UTSW 15 102981794 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATTACGTGGACTCGCTCATC -3'
(R):5'- GTACATGTAGTCCGGGTAGC -3'

Sequencing Primer
(F):5'- TCGCTCATCTCTCACGACAATGAAG -3'
(R):5'- TAGTCCGGGTAGCTGCGG -3'
Posted On 2017-01-03