Incidental Mutation 'R5700:Klhl6'
ID450867
Institutional Source Beutler Lab
Gene Symbol Klhl6
Ensembl Gene ENSMUSG00000043008
Gene Namekelch-like 6
Synonyms
MMRRC Submission 043328-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R5700 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location19946496-19983037 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 19957218 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 197 (Q197*)
Ref Sequence ENSEMBL: ENSMUSP00000053023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058839] [ENSMUST00000166801]
Predicted Effect probably null
Transcript: ENSMUST00000058839
AA Change: Q197*
SMART Domains Protein: ENSMUSP00000053023
Gene: ENSMUSG00000043008
AA Change: Q197*

DomainStartEndE-ValueType
BTB 70 167 1.43e-25 SMART
BACK 172 274 1.68e-35 SMART
Kelch 376 419 3.05e-1 SMART
Kelch 420 466 6.82e-11 SMART
Kelch 467 514 4.27e-3 SMART
Kelch 515 556 3.06e-4 SMART
Kelch 557 604 3.47e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166801
SMART Domains Protein: ENSMUSP00000130755
Gene: ENSMUSG00000043008

DomainStartEndE-ValueType
Pfam:BTB 60 98 1.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171910
Meta Mutation Damage Score 0.588 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kelch-like (KLHL) family of proteins, which is involved in B-lymphocyte antigen receptor signaling and germinal-center B-cell maturation. The encoded protein contains an N-terminal broad-complex, tramtrack and bric a brac (BTB) domain that facilitates protein binding and dimerization, a BTB and C-terminal kelch (BACK) domain, and six C-terminal kelch repeat domains. Naturally occurring mutations in this gene are associated with chronic lymphocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit spleen hypoplasia, defects in mature B-cell subsets with normal pro- and pre-B-cell development, severely impaired antigen-dependent germinal center formation, and reduced memory IgG response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,798,194 Q155L probably benign Het
Acadvl A C 11: 70,013,203 Y242D probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Barx2 A T 9: 31,858,765 F156I probably damaging Het
Best1 T C 19: 9,997,199 probably benign Het
Btbd8 T C 5: 107,503,648 S136P possibly damaging Het
Btla T A 16: 45,250,573 Y298* probably null Het
Casr T A 16: 36,509,617 I452F probably damaging Het
Ccser1 C A 6: 61,311,276 P141H probably benign Het
Cr2 A G 1: 195,159,757 V296A probably damaging Het
Csl T A 10: 99,759,015 I63F probably damaging Het
Dbt G A 3: 116,520,303 V40M probably damaging Het
Fam53b A T 7: 132,760,020 L93Q probably damaging Het
Fdps T C 3: 89,095,649 I105V probably damaging Het
Gm4884 A G 7: 41,043,219 D204G probably benign Het
Gm5592 A G 7: 41,158,579 probably benign Het
Gm7367 A T 7: 60,155,762 noncoding transcript Het
Grid2 T A 6: 64,094,432 V413D possibly damaging Het
Hgf C T 5: 16,610,124 P471L probably damaging Het
Hoxc9 T C 15: 102,981,881 Y77H possibly damaging Het
Hs6st3 C T 14: 119,138,787 R125* probably null Het
Kdm4b T C 17: 56,351,700 I15T possibly damaging Het
Klhl1 T C 14: 96,518,040 N93S probably benign Het
Medag T C 5: 149,422,217 V7A probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Nckap5 C T 1: 125,976,925 probably null Het
Obscn T C 11: 59,133,194 K550R probably benign Het
Olfr1369-ps1 T A 13: 21,116,001 V103E probably damaging Het
Olfr193 T A 16: 59,109,993 I206F probably damaging Het
Olfr716 A G 7: 107,147,541 N75S probably benign Het
Olfr8 T C 10: 78,955,484 I93T probably damaging Het
Parp6 T C 9: 59,624,727 S101P probably damaging Het
Plcd3 T C 11: 103,073,763 N594S probably benign Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Ppp2r1b T C 9: 50,878,157 Y443H probably damaging Het
Pqlc2 C T 4: 139,300,254 S259N probably damaging Het
Prnd G A 2: 131,953,343 V128I probably benign Het
Rftn1 G T 17: 50,002,669 P156Q probably damaging Het
Scmh1 T C 4: 120,516,946 V445A probably benign Het
Serpinb6c A T 13: 33,899,308 M41K probably damaging Het
Spns1 A G 7: 126,372,469 V303A possibly damaging Het
Ston1 T A 17: 88,644,339 S639R probably damaging Het
Thbs4 T C 13: 92,776,953 D153G probably benign Het
Timm44 T C 8: 4,274,171 Y36C probably damaging Het
Trim34b G T 7: 104,336,411 V418F probably damaging Het
Vmn1r72 C T 7: 11,670,423 V33M probably damaging Het
Zcchc7 T C 4: 44,931,084 V412A probably benign Het
Zfand1 T A 3: 10,341,019 N210I probably damaging Het
Zfhx3 A G 8: 108,933,867 H1251R probably damaging Het
Other mutations in Klhl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Klhl6 APN 16 19957062 missense probably benign 0.00
IGL01465:Klhl6 APN 16 19982822 missense probably damaging 0.98
IGL01831:Klhl6 APN 16 19953485 missense probably damaging 1.00
IGL01971:Klhl6 APN 16 19949526 missense probably damaging 0.99
IGL02532:Klhl6 APN 16 19957082 missense possibly damaging 0.84
IGL03113:Klhl6 APN 16 19957251 missense possibly damaging 0.68
IGL03290:Klhl6 APN 16 19947137 missense probably benign 0.44
Ascension UTSW 16 19947098 missense probably damaging 1.00
besmirched UTSW 16 19949447 splice site probably null
blossom UTSW 16 19957139 missense probably damaging 1.00
cerulean UTSW 16 19957218 nonsense probably null
heights UTSW 16 19957028 missense probably damaging 0.98
Lazuli UTSW 16 19956966 frame shift probably null
Parula UTSW 16 19957043 missense possibly damaging 0.56
torres_del_paine UTSW 16 19948127 missense probably damaging 1.00
IGL03046:Klhl6 UTSW 16 19982889 missense probably benign
R0265:Klhl6 UTSW 16 19948234 missense probably benign 0.43
R0496:Klhl6 UTSW 16 19956966 frame shift probably null
R0497:Klhl6 UTSW 16 19956966 frame shift probably null
R0540:Klhl6 UTSW 16 19957014 missense possibly damaging 0.95
R0541:Klhl6 UTSW 16 19949447 splice site probably null
R0554:Klhl6 UTSW 16 19953593 missense probably damaging 0.96
R0607:Klhl6 UTSW 16 19957014 missense possibly damaging 0.95
R0636:Klhl6 UTSW 16 19948073 splice site probably benign
R0670:Klhl6 UTSW 16 19949559 missense possibly damaging 0.92
R1477:Klhl6 UTSW 16 19965977 missense probably benign 0.00
R1510:Klhl6 UTSW 16 19947098 missense probably damaging 1.00
R1547:Klhl6 UTSW 16 19966082 missense probably benign
R1747:Klhl6 UTSW 16 19947028 missense probably benign 0.40
R1871:Klhl6 UTSW 16 19957043 missense possibly damaging 0.56
R1966:Klhl6 UTSW 16 19982822 missense probably damaging 0.98
R2058:Klhl6 UTSW 16 19982931 missense probably benign
R4466:Klhl6 UTSW 16 19957268 missense probably damaging 0.99
R4645:Klhl6 UTSW 16 19947147 missense probably damaging 1.00
R4690:Klhl6 UTSW 16 19957284 missense probably benign 0.44
R4824:Klhl6 UTSW 16 19957028 missense probably damaging 0.98
R4833:Klhl6 UTSW 16 19957139 missense probably damaging 1.00
R4835:Klhl6 UTSW 16 19957033 missense probably benign 0.07
R5001:Klhl6 UTSW 16 19946991 makesense probably null
R5475:Klhl6 UTSW 16 19948127 missense probably damaging 1.00
R5867:Klhl6 UTSW 16 19982820 missense probably benign 0.37
R5910:Klhl6 UTSW 16 19957094 missense probably benign 0.04
R6992:Klhl6 UTSW 16 19953587 missense probably damaging 1.00
R7082:Klhl6 UTSW 16 19982883 missense probably benign 0.00
R7262:Klhl6 UTSW 16 19982796 missense probably damaging 1.00
R7314:Klhl6 UTSW 16 19957005 missense probably damaging 1.00
R7464:Klhl6 UTSW 16 19957113 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- ATCTCCACGAAGTACCACGG -3'
(R):5'- GGATGATCACTTTCTGGTCTGAC -3'

Sequencing Primer
(F):5'- GTGGTAAACGCACATTCTCG -3'
(R):5'- GATCACTTTCTGGTCTGACTTTCTTC -3'
Posted On2017-01-03