Mutagenetix > Incidental Mutation

Incidental Mutation 'R5700:Casr'

450868

Institutional Source

Beutler Lab

Gene Symbol

Casr

Ensembl Gene

ENSMUSG00000051980

Gene Name

calcium-sensing receptor

Synonyms

CaR, cation sensing receptor, Gprc2a

MMRRC Submission

043328-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5700 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

36493696-36562141 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 36509617 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 452 (I452F)

Ref Sequence

ENSEMBL: ENSMUSP00000133500 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063597] [ENSMUST00000114847] [ENSMUST00000172826]

AlphaFold

Q9QY96

Predicted Effect

probably damaging
Transcript: ENSMUST00000063597
AA Change: I452F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000069080
Gene: ENSMUSG00000051980
AA Change: I452F

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Peripla_BP_6	63	321	1e-13	PFAM
Pfam:ANF_receptor	69	495	1.1e-114	PFAM
Pfam:NCD3G	538	591	1.4e-20	PFAM
Pfam:7tm_3	624	859	7.4e-61	PFAM
low complexity region	894	920	N/A	INTRINSIC
low complexity region	930	961	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000114847
AA Change: I452F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000110496
Gene: ENSMUSG00000051980
AA Change: I452F

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Peripla_BP_6	63	321	2.1e-14	PFAM
Pfam:ANF_receptor	69	461	2.8e-99	PFAM
Pfam:NCD3G	461	514	1.2e-20	PFAM
Pfam:7tm_3	545	783	9.9e-87	PFAM
low complexity region	817	843	N/A	INTRINSIC
low complexity region	853	884	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158493

Predicted Effect

probably damaging
Transcript: ENSMUST00000172826
AA Change: I452F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000133500
Gene: ENSMUSG00000051980
AA Change: I452F

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Peripla_BP_6	63	321	2.4e-14	PFAM
Pfam:ANF_receptor	69	495	3.9e-111	PFAM
Pfam:NCD3G	538	591	1.4e-20	PFAM
Pfam:7tm_3	622	860	1.1e-86	PFAM
low complexity region	894	920	N/A	INTRINSIC
low complexity region	930	961	N/A	INTRINSIC

Meta Mutation Damage Score

0.3731

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G protein-coupled receptor that is expressed in the parathyroid hormone (PTH)-producing chief cells of the parathyroid gland, and the cells lining the kidney tubule. It senses small changes in circulating calcium concentration and couples this information to intracellular signaling pathways that modify PTH secretion or renal cation handling, thus this protein plays an essential role in maintaining mineral ion homeostasis. Mutations in this gene cause familial hypocalciuric hypercalcemia, familial, isolated hypoparathyroidism, and neonatal severe primary hyperparathyroidism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high levels of serum calcium and parathyroid hormone, parathyroid hyperplasia, bone defects, reduced growth, and early death. Carriers have elevated serum calcium, magnesium, and parathyroid hormone levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc2	A	T	19: 43,798,194	Q155L	probably benign	Het
Acadvl	A	C	11: 70,013,203	Y242D	probably damaging	Het
Armc8	A	G	9: 99,496,149		probably null	Het
Barx2	A	T	9: 31,858,765	F156I	probably damaging	Het
Best1	T	C	19: 9,997,199		probably benign	Het
Btbd8	T	C	5: 107,503,648	S136P	possibly damaging	Het
Btla	T	A	16: 45,250,573	Y298*	probably null	Het
Ccser1	C	A	6: 61,311,276	P141H	probably benign	Het
Cr2	A	G	1: 195,159,757	V296A	probably damaging	Het
Csl	T	A	10: 99,759,015	I63F	probably damaging	Het
Dbt	G	A	3: 116,520,303	V40M	probably damaging	Het
Fam53b	A	T	7: 132,760,020	L93Q	probably damaging	Het
Fdps	T	C	3: 89,095,649	I105V	probably damaging	Het
Gm4884	A	G	7: 41,043,219	D204G	probably benign	Het
Gm5592	A	G	7: 41,158,579		probably benign	Het
Gm7367	A	T	7: 60,155,762		noncoding transcript	Het
Grid2	T	A	6: 64,094,432	V413D	possibly damaging	Het
Hgf	C	T	5: 16,610,124	P471L	probably damaging	Het
Hoxc9	T	C	15: 102,981,881	Y77H	possibly damaging	Het
Hs6st3	C	T	14: 119,138,787	R125*	probably null	Het
Kdm4b	T	C	17: 56,351,700	I15T	possibly damaging	Het
Klhl1	T	C	14: 96,518,040	N93S	probably benign	Het
Klhl6	G	A	16: 19,957,218	Q197*	probably null	Het
Medag	T	C	5: 149,422,217	V7A	probably benign	Het
Mptx2	G	A	1: 173,274,847	L92F	probably benign	Het
Nckap5	C	T	1: 125,976,925		probably null	Het
Obscn	T	C	11: 59,133,194	K550R	probably benign	Het
Olfr1369-ps1	T	A	13: 21,116,001	V103E	probably damaging	Het
Olfr193	T	A	16: 59,109,993	I206F	probably damaging	Het
Olfr716	A	G	7: 107,147,541	N75S	probably benign	Het
Olfr8	T	C	10: 78,955,484	I93T	probably damaging	Het
Parp6	T	C	9: 59,624,727	S101P	probably damaging	Het
Plcd3	T	C	11: 103,073,763	N594S	probably benign	Het
Plscr5	A	T	9: 92,205,511	K178*	probably null	Het
Ppp2r1b	T	C	9: 50,878,157	Y443H	probably damaging	Het
Pqlc2	C	T	4: 139,300,254	S259N	probably damaging	Het
Prnd	G	A	2: 131,953,343	V128I	probably benign	Het
Rftn1	G	T	17: 50,002,669	P156Q	probably damaging	Het
Scmh1	T	C	4: 120,516,946	V445A	probably benign	Het
Serpinb6c	A	T	13: 33,899,308	M41K	probably damaging	Het
Spns1	A	G	7: 126,372,469	V303A	possibly damaging	Het
Ston1	T	A	17: 88,644,339	S639R	probably damaging	Het
Thbs4	T	C	13: 92,776,953	D153G	probably benign	Het
Timm44	T	C	8: 4,274,171	Y36C	probably damaging	Het
Trim34b	G	T	7: 104,336,411	V418F	probably damaging	Het
Vmn1r72	C	T	7: 11,670,423	V33M	probably damaging	Het
Zcchc7	T	C	4: 44,931,084	V412A	probably benign	Het
Zfand1	T	A	3: 10,341,019	N210I	probably damaging	Het
Zfhx3	A	G	8: 108,933,867	H1251R	probably damaging	Het

Other mutations in Casr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Casr	APN	16	36495810	missense	probably damaging	1.00
IGL01587:Casr	APN	16	36509765	missense	probably benign
IGL02323:Casr	APN	16	36509710	missense	probably damaging	1.00
IGL02369:Casr	APN	16	36494689	missense	probably benign	0.03
IGL02514:Casr	APN	16	36500325	missense	probably damaging	1.00
IGL02547:Casr	APN	16	36515674	missense	probably benign	0.06
IGL02633:Casr	APN	16	36515655	missense	probably damaging	1.00
IGL03061:Casr	APN	16	36495888	missense	probably benign	0.07
R1163:Casr	UTSW	16	36494807	missense	probably damaging	1.00
R1539:Casr	UTSW	16	36495137	missense	probably benign	0.10
R1643:Casr	UTSW	16	36500205	missense	probably damaging	1.00
R1664:Casr	UTSW	16	36509965	nonsense	probably null
R1694:Casr	UTSW	16	36495591	missense	probably damaging	1.00
R2040:Casr	UTSW	16	36510366	missense	possibly damaging	0.79
R2092:Casr	UTSW	16	36510043	missense	possibly damaging	0.96
R2125:Casr	UTSW	16	36495252	missense	possibly damaging	0.90
R2190:Casr	UTSW	16	36495416	missense	probably damaging	1.00
R2214:Casr	UTSW	16	36515758	missense	probably damaging	1.00
R4409:Casr	UTSW	16	36500341	missense	probably benign	0.01
R4410:Casr	UTSW	16	36500341	missense	probably benign	0.01
R4591:Casr	UTSW	16	36500370	missense	probably benign	0.05
R5451:Casr	UTSW	16	36509908	missense	probably damaging	0.99
R5469:Casr	UTSW	16	36510030	missense	probably benign	0.29
R5581:Casr	UTSW	16	36494744	missense	probably benign	0.01
R6258:Casr	UTSW	16	36517609	missense	probably damaging	1.00
R6447:Casr	UTSW	16	36495545	missense	probably damaging	1.00
R6751:Casr	UTSW	16	36515588	missense	probably benign	0.00
R6938:Casr	UTSW	16	36495921	missense	probably damaging	1.00
R7063:Casr	UTSW	16	36494574	missense	probably benign	0.00
R7313:Casr	UTSW	16	36509671	missense	probably damaging	1.00
R7789:Casr	UTSW	16	36495291	missense	probably damaging	1.00
R8013:Casr	UTSW	16	36509644	missense	probably benign	0.22
R8026:Casr	UTSW	16	36495617	missense	probably damaging	1.00
R8141:Casr	UTSW	16	36494811	missense	probably damaging	1.00
R8184:Casr	UTSW	16	36509746	missense	probably benign
R8278:Casr	UTSW	16	36515649	missense	probably damaging	1.00
R8386:Casr	UTSW	16	36515588	missense	probably damaging	0.96
R8393:Casr	UTSW	16	36510204	missense	probably benign	0.02
R8682:Casr	UTSW	16	36495422	missense	possibly damaging	0.65
R9020:Casr	UTSW	16	36495249	missense	probably damaging	1.00
R9051:Casr	UTSW	16	36510052	missense	probably benign	0.00
R9260:Casr	UTSW	16	36509964	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGGTTTCATGAATCCAATGTCCT -3'
(R):5'- GAAGGCGGCAACAGGTTACT -3'

Sequencing Primer
(F):5'- GCTAGACCTTTGGAAACCATGAGTC -3'
(R):5'- AGGTTACTCAATAGCTCCACTG -3'

Posted On

2017-01-03