Mutagenetix > Incidental Mutations

Incidental Mutation 'R5700:Rftn1'

450871

Institutional Source

Beutler Lab

Gene Symbol

Rftn1

Ensembl Gene

ENSMUSG00000039316

Gene Name

raftlin lipid raft linker 1

Synonyms

2310015N21Rik

MMRRC Submission

043328-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.075) question?

Stock #

R5700 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

49992257-50190674 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 50002669 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Glutamine at position 156 (P156Q)

Ref Sequence

ENSEMBL: ENSMUSP00000108820 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044503] [ENSMUST00000113195]

AlphaFold

Q6A0D4

Predicted Effect

probably damaging
Transcript: ENSMUST00000044503
AA Change: P434Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000046524
Gene: ENSMUSG00000039316
AA Change: P434Q

Domain	Start	End	E-Value	Type
Pfam:Raftlin	1	473	1.3e-219	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113195
AA Change: P156Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108820
Gene: ENSMUSG00000039316
AA Change: P156Q

Domain	Start	End	E-Value	Type
Pfam:Raftlin	1	207	1.5e-104	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

98% (50/51)

MGI Phenotype

PHENOTYPE: Mice homozygous for null mutations have defects in T cell activation, T cell help to B cells, and Th17 differentation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc2	A	T	19: 43,798,194	Q155L	probably benign	Het
Acadvl	A	C	11: 70,013,203	Y242D	probably damaging	Het
Armc8	A	G	9: 99,496,149		probably null	Het
Barx2	A	T	9: 31,858,765	F156I	probably damaging	Het
Best1	T	C	19: 9,997,199		probably benign	Het
Btbd8	T	C	5: 107,503,648	S136P	possibly damaging	Het
Btla	T	A	16: 45,250,573	Y298*	probably null	Het
Casr	T	A	16: 36,509,617	I452F	probably damaging	Het
Ccser1	C	A	6: 61,311,276	P141H	probably benign	Het
Cr2	A	G	1: 195,159,757	V296A	probably damaging	Het
Csl	T	A	10: 99,759,015	I63F	probably damaging	Het
Dbt	G	A	3: 116,520,303	V40M	probably damaging	Het
Fam53b	A	T	7: 132,760,020	L93Q	probably damaging	Het
Fdps	T	C	3: 89,095,649	I105V	probably damaging	Het
Gm4884	A	G	7: 41,043,219	D204G	probably benign	Het
Gm5592	A	G	7: 41,158,579		probably benign	Het
Gm7367	A	T	7: 60,155,762		noncoding transcript	Het
Grid2	T	A	6: 64,094,432	V413D	possibly damaging	Het
Hgf	C	T	5: 16,610,124	P471L	probably damaging	Het
Hoxc9	T	C	15: 102,981,881	Y77H	possibly damaging	Het
Hs6st3	C	T	14: 119,138,787	R125*	probably null	Het
Kdm4b	T	C	17: 56,351,700	I15T	possibly damaging	Het
Klhl1	T	C	14: 96,518,040	N93S	probably benign	Het
Klhl6	G	A	16: 19,957,218	Q197*	probably null	Het
Medag	T	C	5: 149,422,217	V7A	probably benign	Het
Mptx2	G	A	1: 173,274,847	L92F	probably benign	Het
Nckap5	C	T	1: 125,976,925		probably null	Het
Obscn	T	C	11: 59,133,194	K550R	probably benign	Het
Olfr1369-ps1	T	A	13: 21,116,001	V103E	probably damaging	Het
Olfr193	T	A	16: 59,109,993	I206F	probably damaging	Het
Olfr716	A	G	7: 107,147,541	N75S	probably benign	Het
Olfr8	T	C	10: 78,955,484	I93T	probably damaging	Het
Parp6	T	C	9: 59,624,727	S101P	probably damaging	Het
Plcd3	T	C	11: 103,073,763	N594S	probably benign	Het
Plscr5	A	T	9: 92,205,511	K178*	probably null	Het
Ppp2r1b	T	C	9: 50,878,157	Y443H	probably damaging	Het
Pqlc2	C	T	4: 139,300,254	S259N	probably damaging	Het
Prnd	G	A	2: 131,953,343	V128I	probably benign	Het
Scmh1	T	C	4: 120,516,946	V445A	probably benign	Het
Serpinb6c	A	T	13: 33,899,308	M41K	probably damaging	Het
Spns1	A	G	7: 126,372,469	V303A	possibly damaging	Het
Ston1	T	A	17: 88,644,339	S639R	probably damaging	Het
Thbs4	T	C	13: 92,776,953	D153G	probably benign	Het
Timm44	T	C	8: 4,274,171	Y36C	probably damaging	Het
Trim34b	G	T	7: 104,336,411	V418F	probably damaging	Het
Vmn1r72	C	T	7: 11,670,423	V33M	probably damaging	Het
Zcchc7	T	C	4: 44,931,084	V412A	probably benign	Het
Zfand1	T	A	3: 10,341,019	N210I	probably damaging	Het
Zfhx3	A	G	8: 108,933,867	H1251R	probably damaging	Het

Other mutations in Rftn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00552:Rftn1	APN	17	50055377	missense	probably benign	0.01
IGL02318:Rftn1	APN	17	50036970	missense	possibly damaging	0.95
IGL02568:Rftn1	APN	17	50036999	missense	probably damaging	1.00
IGL02873:Rftn1	APN	17	50169152	utr 5 prime	probably benign
IGL02965:Rftn1	APN	17	50055252	missense	probably benign	0.32
BB001:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
BB003:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
BB004:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
BB005:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
BB011:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
BB013:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
BB014:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
BB015:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R0544:Rftn1	UTSW	17	49994261	missense	possibly damaging	0.71
R2219:Rftn1	UTSW	17	50169145	start codon destroyed	probably null	1.00
R4542:Rftn1	UTSW	17	50055231	splice site	probably null
R5318:Rftn1	UTSW	17	49994458	missense	probably benign	0.09
R5605:Rftn1	UTSW	17	50047407	missense	probably damaging	1.00
R5853:Rftn1	UTSW	17	50047326	missense	probably damaging	1.00
R6459:Rftn1	UTSW	17	50047306	missense	probably benign	0.02
R6994:Rftn1	UTSW	17	50036991	missense	possibly damaging	0.82
R7210:Rftn1	UTSW	17	49994307	nonsense	probably null
R7283:Rftn1	UTSW	17	50047441	missense	probably damaging	1.00
R7348:Rftn1	UTSW	17	50004323	missense	probably damaging	1.00
R7444:Rftn1	UTSW	17	50047407	missense	probably damaging	1.00
R7684:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R7685:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R7686:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R7881:Rftn1	UTSW	17	50047435	missense	probably benign	0.08
R7924:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R7926:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R7927:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R7928:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R7943:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8052:Rftn1	UTSW	17	50086579	missense	probably damaging	0.98
R8162:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8164:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8248:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8249:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8250:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8271:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8272:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8273:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8296:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8297:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8300:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8315:Rftn1	UTSW	17	50002637	missense	possibly damaging	0.50
R8551:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8552:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8554:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8555:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8725:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8736:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
R8739:Rftn1	UTSW	17	50047380	missense	probably damaging	1.00
Z1176:Rftn1	UTSW	17	50169003	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCTATGACCCAATGTGGACC -3'
(R):5'- CAGTCTTAAGTCAGGCAGCAGC -3'

Sequencing Primer
(F):5'- CAATGTGGACCCAGGTCTTCATTG -3'
(R):5'- GCAGCCTTCCTTTACTTATAGGAAG -3'

Posted On

2017-01-03