Incidental Mutation 'R5700:Kdm4b'
ID 450872
Institutional Source Beutler Lab
Gene Symbol Kdm4b
Ensembl Gene ENSMUSG00000024201
Gene Name lysine (K)-specific demethylase 4B
Synonyms Jmjd2b, 4732474L06Rik
MMRRC Submission 043328-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5700 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 56326062-56402870 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 56351700 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 15 (I15T)
Ref Sequence ENSEMBL: ENSMUSP00000118089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025036] [ENSMUST00000086835] [ENSMUST00000139679]
AlphaFold Q91VY5
Predicted Effect possibly damaging
Transcript: ENSMUST00000025036
AA Change: I15T

PolyPhen 2 Score 0.715 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000025036
Gene: ENSMUSG00000024201
AA Change: I15T

DomainStartEndE-ValueType
JmjN 14 56 5.88e-17 SMART
low complexity region 61 68 N/A INTRINSIC
JmjC 143 309 1.19e-59 SMART
low complexity region 349 361 N/A INTRINSIC
low complexity region 380 399 N/A INTRINSIC
low complexity region 443 449 N/A INTRINSIC
low complexity region 481 495 N/A INTRINSIC
low complexity region 511 537 N/A INTRINSIC
PHD 719 777 2.5e-5 SMART
PHD 839 895 7.07e-5 SMART
TUDOR 905 962 1.68e-9 SMART
TUDOR 963 1019 7.94e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000086835
AA Change: I15T

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000084045
Gene: ENSMUSG00000024201
AA Change: I15T

DomainStartEndE-ValueType
JmjN 14 56 5.88e-17 SMART
low complexity region 61 68 N/A INTRINSIC
JmjC 143 309 1.19e-59 SMART
low complexity region 349 361 N/A INTRINSIC
low complexity region 380 399 N/A INTRINSIC
low complexity region 443 449 N/A INTRINSIC
low complexity region 481 495 N/A INTRINSIC
low complexity region 511 537 N/A INTRINSIC
PHD 712 770 2.5e-5 SMART
PHD 832 888 7.07e-5 SMART
TUDOR 898 954 2.31e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000139679
AA Change: I15T

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118089
Gene: ENSMUSG00000024201
AA Change: I15T

DomainStartEndE-ValueType
JmjN 14 56 5.88e-17 SMART
low complexity region 61 68 N/A INTRINSIC
Pfam:JmjC 176 208 5.8e-13 PFAM
Meta Mutation Damage Score 0.9501 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (50/51)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele lacking demethylase activity exhibit no gross abnormalities. Mice homozygous for a conditional allele activated in mammary gland epithelial cells exhibit delayed mammary gland development with reduced branching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,798,194 Q155L probably benign Het
Acadvl A C 11: 70,013,203 Y242D probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Barx2 A T 9: 31,858,765 F156I probably damaging Het
Best1 T C 19: 9,997,199 probably benign Het
Btbd8 T C 5: 107,503,648 S136P possibly damaging Het
Btla T A 16: 45,250,573 Y298* probably null Het
Casr T A 16: 36,509,617 I452F probably damaging Het
Ccser1 C A 6: 61,311,276 P141H probably benign Het
Cr2 A G 1: 195,159,757 V296A probably damaging Het
Csl T A 10: 99,759,015 I63F probably damaging Het
Dbt G A 3: 116,520,303 V40M probably damaging Het
Fam53b A T 7: 132,760,020 L93Q probably damaging Het
Fdps T C 3: 89,095,649 I105V probably damaging Het
Gm4884 A G 7: 41,043,219 D204G probably benign Het
Gm5592 A G 7: 41,158,579 probably benign Het
Gm7367 A T 7: 60,155,762 noncoding transcript Het
Grid2 T A 6: 64,094,432 V413D possibly damaging Het
Hgf C T 5: 16,610,124 P471L probably damaging Het
Hoxc9 T C 15: 102,981,881 Y77H possibly damaging Het
Hs6st3 C T 14: 119,138,787 R125* probably null Het
Klhl1 T C 14: 96,518,040 N93S probably benign Het
Klhl6 G A 16: 19,957,218 Q197* probably null Het
Medag T C 5: 149,422,217 V7A probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Nckap5 C T 1: 125,976,925 probably null Het
Obscn T C 11: 59,133,194 K550R probably benign Het
Olfr1369-ps1 T A 13: 21,116,001 V103E probably damaging Het
Olfr193 T A 16: 59,109,993 I206F probably damaging Het
Olfr716 A G 7: 107,147,541 N75S probably benign Het
Olfr8 T C 10: 78,955,484 I93T probably damaging Het
Parp6 T C 9: 59,624,727 S101P probably damaging Het
Plcd3 T C 11: 103,073,763 N594S probably benign Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Ppp2r1b T C 9: 50,878,157 Y443H probably damaging Het
Pqlc2 C T 4: 139,300,254 S259N probably damaging Het
Prnd G A 2: 131,953,343 V128I probably benign Het
Rftn1 G T 17: 50,002,669 P156Q probably damaging Het
Scmh1 T C 4: 120,516,946 V445A probably benign Het
Serpinb6c A T 13: 33,899,308 M41K probably damaging Het
Spns1 A G 7: 126,372,469 V303A possibly damaging Het
Ston1 T A 17: 88,644,339 S639R probably damaging Het
Thbs4 T C 13: 92,776,953 D153G probably benign Het
Timm44 T C 8: 4,274,171 Y36C probably damaging Het
Trim34b G T 7: 104,336,411 V418F probably damaging Het
Vmn1r72 C T 7: 11,670,423 V33M probably damaging Het
Zcchc7 T C 4: 44,931,084 V412A probably benign Het
Zfand1 T A 3: 10,341,019 N210I probably damaging Het
Zfhx3 A G 8: 108,933,867 H1251R probably damaging Het
Other mutations in Kdm4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Kdm4b APN 17 56353019 missense probably benign 0.28
IGL01408:Kdm4b APN 17 56353518 splice site probably benign
IGL01610:Kdm4b APN 17 56353522 splice site probably benign
IGL01936:Kdm4b APN 17 56397355 missense probably damaging 1.00
IGL01964:Kdm4b APN 17 56389256 splice site probably null
IGL02151:Kdm4b APN 17 56396234 missense probably benign 0.05
IGL02596:Kdm4b APN 17 56399706 missense probably benign 0.14
IGL02975:Kdm4b APN 17 56375996 splice site probably null
IGL03172:Kdm4b APN 17 56401649 missense probably damaging 0.98
Coelestinum UTSW 17 56353091 missense probably benign 0.31
mistflower UTSW 17 56389564 missense possibly damaging 0.65
R0193:Kdm4b UTSW 17 56393952 missense probably benign 0.04
R0311:Kdm4b UTSW 17 56386200 missense probably benign 0.42
R0331:Kdm4b UTSW 17 56386289 splice site probably benign
R1109:Kdm4b UTSW 17 56399430 missense probably damaging 0.99
R1499:Kdm4b UTSW 17 56400025 missense probably damaging 1.00
R1895:Kdm4b UTSW 17 56397340 missense probably damaging 1.00
R1985:Kdm4b UTSW 17 56401302 missense probably damaging 1.00
R2087:Kdm4b UTSW 17 56389564 missense possibly damaging 0.65
R2185:Kdm4b UTSW 17 56393750 missense probably benign 0.00
R2904:Kdm4b UTSW 17 56355884 missense probably benign 0.03
R3792:Kdm4b UTSW 17 56355944 missense probably damaging 1.00
R3897:Kdm4b UTSW 17 56396955 missense probably damaging 1.00
R4661:Kdm4b UTSW 17 56399459 missense probably damaging 1.00
R4685:Kdm4b UTSW 17 56401675 missense probably benign 0.06
R4716:Kdm4b UTSW 17 56386178 missense probably benign 0.10
R4790:Kdm4b UTSW 17 56401618 missense probably damaging 0.97
R4864:Kdm4b UTSW 17 56353091 missense probably benign 0.31
R5963:Kdm4b UTSW 17 56399732 missense probably damaging 1.00
R6003:Kdm4b UTSW 17 56396916 missense probably damaging 1.00
R6029:Kdm4b UTSW 17 56396576 missense probably damaging 0.98
R6769:Kdm4b UTSW 17 56351754 missense possibly damaging 0.54
R6771:Kdm4b UTSW 17 56351754 missense possibly damaging 0.54
R6927:Kdm4b UTSW 17 56399435 missense probably damaging 1.00
R7041:Kdm4b UTSW 17 56396592 missense probably damaging 0.96
R7230:Kdm4b UTSW 17 56369155 missense probably damaging 1.00
R7275:Kdm4b UTSW 17 56396333 missense probably damaging 0.99
R7454:Kdm4b UTSW 17 56389639 missense probably benign 0.00
R7455:Kdm4b UTSW 17 56396657 missense probably damaging 0.98
R7457:Kdm4b UTSW 17 56396319 missense probably damaging 1.00
R8171:Kdm4b UTSW 17 56389534 missense probably damaging 0.99
R8367:Kdm4b UTSW 17 56355875 missense probably damaging 1.00
R8524:Kdm4b UTSW 17 56399384 missense probably damaging 1.00
R8810:Kdm4b UTSW 17 56399771 missense probably damaging 1.00
R9260:Kdm4b UTSW 17 56394775 missense probably benign
R9459:Kdm4b UTSW 17 56399509 missense probably benign 0.15
R9466:Kdm4b UTSW 17 56389548 missense probably benign 0.04
R9559:Kdm4b UTSW 17 56386228 missense probably damaging 1.00
X0024:Kdm4b UTSW 17 56401278 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTCAACCGGTGTCACCTTG -3'
(R):5'- TCCATGTTTAAGAAGGTCGGGG -3'

Sequencing Primer
(F):5'- CGGTGTCACCTTGGCTTTTGAC -3'
(R):5'- TTTAAGAAGGTCGGGGAGGCAG -3'
Posted On 2017-01-03