Incidental Mutation 'R0550:Whamm'
ID 45088
Institutional Source Beutler Lab
Gene Symbol Whamm
Ensembl Gene ENSMUSG00000045795
Gene Name WAS protein homolog associated with actin, golgi membranes and microtubules
Synonyms Whdc1
MMRRC Submission 038742-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0550 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 81221014-81246584 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 81235972 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 392 (V392I)
Ref Sequence ENSEMBL: ENSMUSP00000128881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165460] [ENSMUST00000207123] [ENSMUST00000209044]
AlphaFold Q571B6
Predicted Effect possibly damaging
Transcript: ENSMUST00000165460
AA Change: V392I

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128881
Gene: ENSMUSG00000045795
AA Change: V392I

DomainStartEndE-ValueType
Pfam:WHAMM-JMY_N 5 54 1.1e-30 PFAM
Pfam:JMY 67 435 1.3e-157 PFAM
coiled coil region 448 470 N/A INTRINSIC
low complexity region 509 522 N/A INTRINSIC
low complexity region 631 656 N/A INTRINSIC
WH2 698 716 5.69e2 SMART
WH2 728 745 6.26e-2 SMART
coiled coil region 758 785 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208537
Predicted Effect possibly damaging
Transcript: ENSMUST00000209044
AA Change: V186I

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.0708 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays a role in actin nucleation, Golgi membrane association and microtubule binding. The encoded protein is a nucleation-promoting factor that regulates the Actin-related protein 2/3 complex. The activated complex initiates growth of new actin filaments by binding to existing actin filaments. The encoded protein also functions in regulation of transport from the endoplasmic reticulum to the Golgi complex and in maintenance of the Golgi complex near the centrosome. Four pseudogenes of this gene are present on the same arm of chromosome 15 as this gene. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,184,666 (GRCm39) Y947N probably damaging Het
Acss3 C A 10: 106,889,332 (GRCm39) G163C probably damaging Het
Adcy10 A G 1: 165,392,884 (GRCm39) T1367A probably benign Het
Adcy2 A T 13: 69,130,480 (GRCm39) S136T probably benign Het
Ahdc1 G A 4: 132,790,348 (GRCm39) V530I probably benign Het
Aldh16a1 C T 7: 44,795,653 (GRCm39) probably null Het
Ankrd36 T C 11: 5,557,429 (GRCm39) probably null Het
Aqr A C 2: 113,963,457 (GRCm39) N664K probably damaging Het
Atp6v1c1 T C 15: 38,683,173 (GRCm39) probably benign Het
Atp8b2 C T 3: 89,866,368 (GRCm39) probably benign Het
Bbx T C 16: 50,094,896 (GRCm39) probably benign Het
Bmper T A 9: 23,285,181 (GRCm39) D243E probably benign Het
Casz1 GCCACCACCACCACCACCACCAC GCCACCACCACCACCACCAC 4: 149,036,741 (GRCm39) probably benign Het
Catsperd T C 17: 56,970,427 (GRCm39) probably null Het
Ccdc92b T A 11: 74,520,771 (GRCm39) probably null Het
Cd2bp2 G T 7: 126,792,996 (GRCm39) T342K probably damaging Het
Clrn3 T A 7: 135,130,154 (GRCm39) I27F possibly damaging Het
Cnih3 TTGACGAG T 1: 181,234,042 (GRCm39) probably null Het
Cntnap3 T C 13: 64,909,814 (GRCm39) T764A possibly damaging Het
Cttnbp2 T G 6: 18,435,308 (GRCm39) K183N possibly damaging Het
Cwc27 G A 13: 104,941,457 (GRCm39) P155L probably damaging Het
Dcaf10 T C 4: 45,372,753 (GRCm39) S389P probably benign Het
Ddx18 T C 1: 121,483,104 (GRCm39) K561E probably benign Het
Dkk3 A G 7: 111,757,452 (GRCm39) F51L probably damaging Het
Dnai1 C T 4: 41,596,274 (GRCm39) R20* probably null Het
Dr1 G A 5: 108,417,471 (GRCm39) G6S probably benign Het
Dync2h1 A T 9: 7,120,954 (GRCm39) probably null Het
Eif3l A G 15: 78,961,067 (GRCm39) Y16C probably damaging Het
Epb41 A G 4: 131,702,924 (GRCm39) I464T probably damaging Het
Erc2 A G 14: 27,993,608 (GRCm39) K546E possibly damaging Het
F830045P16Rik T C 2: 129,305,429 (GRCm39) D315G probably damaging Het
Fads6 A G 11: 115,187,503 (GRCm39) I64T probably benign Het
Fshr T C 17: 89,352,553 (GRCm39) N107S probably benign Het
Gbp11 A T 5: 105,491,616 (GRCm39) N60K probably benign Het
Gm2a C T 11: 54,994,491 (GRCm39) Q54* probably null Het
Hydin A G 8: 111,314,407 (GRCm39) D4297G probably benign Het
Il6st G A 13: 112,611,648 (GRCm39) probably null Het
Inpp4b T A 8: 82,723,966 (GRCm39) H499Q probably benign Het
Kif5c A G 2: 49,648,924 (GRCm39) K956R possibly damaging Het
Krt74 G A 15: 101,669,114 (GRCm39) noncoding transcript Het
Map3k9 A T 12: 81,772,555 (GRCm39) L649Q probably damaging Het
Mdn1 A G 4: 32,730,479 (GRCm39) D2871G probably benign Het
Mylk4 T C 13: 32,900,649 (GRCm39) T294A probably benign Het
Nbeal2 C T 9: 110,471,226 (GRCm39) V252I probably benign Het
Nectin3 A G 16: 46,279,183 (GRCm39) I265T possibly damaging Het
Opn1sw A T 6: 29,380,203 (GRCm39) L71Q probably damaging Het
Or4c12 A G 2: 89,773,733 (GRCm39) I242T probably damaging Het
Or52m1 G A 7: 102,290,157 (GRCm39) E235K possibly damaging Het
Or5aq6 G T 2: 86,923,473 (GRCm39) H89Q probably benign Het
Or5b97 A T 19: 12,879,164 (GRCm39) probably null Het
Or5k17 A G 16: 58,746,748 (GRCm39) F62S probably damaging Het
Or8b46 T A 9: 38,450,676 (GRCm39) C162S probably damaging Het
Or8k27 A T 2: 86,276,220 (GRCm39) Y35* probably null Het
Pced1a G A 2: 130,261,553 (GRCm39) P367S probably benign Het
Pkhd1 A T 1: 20,417,447 (GRCm39) M2568K probably null Het
Pla2r1 A G 2: 60,255,694 (GRCm39) probably null Het
Plpp1 T C 13: 112,971,519 (GRCm39) I62T probably benign Het
Polr3g G A 13: 81,842,892 (GRCm39) T41I probably damaging Het
Ptch2 T C 4: 116,953,630 (GRCm39) probably benign Het
Sema4g A T 19: 44,986,104 (GRCm39) H315L probably benign Het
Setd1b G T 5: 123,295,723 (GRCm39) S1097I unknown Het
Sfxn4 A G 19: 60,839,383 (GRCm39) probably benign Het
Sh3tc1 T C 5: 35,857,128 (GRCm39) E1237G probably damaging Het
Slc25a38 A T 9: 119,952,709 (GRCm39) N287I probably benign Het
Slc25a48 A G 13: 56,596,811 (GRCm39) T31A probably benign Het
Slc6a12 G A 6: 121,333,877 (GRCm39) V238I probably damaging Het
Slc8b1 A G 5: 120,669,220 (GRCm39) probably benign Het
Slco4c1 A C 1: 96,795,584 (GRCm39) V158G probably damaging Het
Sptbn4 T C 7: 27,063,803 (GRCm39) T2208A probably benign Het
Srebf1 G A 11: 60,092,502 (GRCm39) T843I probably benign Het
Srl A G 16: 4,305,429 (GRCm39) W101R probably damaging Het
St6galnac4 T A 2: 32,484,031 (GRCm39) C76* probably null Het
Tdrd3 C A 14: 87,723,656 (GRCm39) T290K probably damaging Het
Tnfrsf21 C T 17: 43,349,104 (GRCm39) H239Y probably benign Het
Trpm3 A G 19: 22,965,176 (GRCm39) E1547G probably damaging Het
Ubn1 A G 16: 4,880,484 (GRCm39) probably null Het
Usp10 T A 8: 120,674,540 (GRCm39) I456K probably damaging Het
Usp6nl A G 2: 6,405,134 (GRCm39) probably benign Het
Vit T A 17: 78,932,222 (GRCm39) V443E possibly damaging Het
Zfhx4 A G 3: 5,465,554 (GRCm39) K1904R probably damaging Het
Zfp352 A T 4: 90,112,927 (GRCm39) T356S probably damaging Het
Other mutations in Whamm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Whamm APN 7 81,228,014 (GRCm39) missense probably damaging 1.00
IGL01139:Whamm APN 7 81,245,662 (GRCm39) missense probably damaging 1.00
IGL01870:Whamm APN 7 81,245,722 (GRCm39) missense probably damaging 0.96
IGL03153:Whamm APN 7 81,239,280 (GRCm39) splice site probably benign
R0179:Whamm UTSW 7 81,243,763 (GRCm39) missense probably benign 0.00
R0364:Whamm UTSW 7 81,243,799 (GRCm39) missense probably benign 0.00
R0682:Whamm UTSW 7 81,235,886 (GRCm39) missense probably damaging 1.00
R1388:Whamm UTSW 7 81,236,038 (GRCm39) missense probably damaging 1.00
R1940:Whamm UTSW 7 81,228,047 (GRCm39) missense probably null 0.94
R1991:Whamm UTSW 7 81,241,519 (GRCm39) nonsense probably null
R1992:Whamm UTSW 7 81,241,519 (GRCm39) nonsense probably null
R2103:Whamm UTSW 7 81,241,519 (GRCm39) nonsense probably null
R2104:Whamm UTSW 7 81,241,519 (GRCm39) nonsense probably null
R2162:Whamm UTSW 7 81,221,089 (GRCm39) missense probably damaging 1.00
R2291:Whamm UTSW 7 81,241,519 (GRCm39) nonsense probably null
R3078:Whamm UTSW 7 81,221,532 (GRCm39) missense probably damaging 1.00
R4735:Whamm UTSW 7 81,221,122 (GRCm39) missense probably benign 0.01
R6336:Whamm UTSW 7 81,241,512 (GRCm39) missense probably damaging 1.00
R6723:Whamm UTSW 7 81,245,868 (GRCm39) missense probably damaging 1.00
R6747:Whamm UTSW 7 81,228,050 (GRCm39) critical splice donor site probably null
R7029:Whamm UTSW 7 81,241,574 (GRCm39) missense probably benign 0.09
R7286:Whamm UTSW 7 81,235,995 (GRCm39) missense probably damaging 0.98
R7525:Whamm UTSW 7 81,243,598 (GRCm39) missense probably damaging 1.00
R7732:Whamm UTSW 7 81,221,172 (GRCm39) missense probably damaging 1.00
R8348:Whamm UTSW 7 81,224,295 (GRCm39) missense probably damaging 0.98
R8448:Whamm UTSW 7 81,224,295 (GRCm39) missense probably damaging 0.98
R8769:Whamm UTSW 7 81,234,933 (GRCm39) nonsense probably null
R8890:Whamm UTSW 7 81,243,640 (GRCm39) missense probably benign 0.39
R9226:Whamm UTSW 7 81,243,655 (GRCm39) missense probably damaging 1.00
R9431:Whamm UTSW 7 81,236,035 (GRCm39) missense probably damaging 1.00
R9436:Whamm UTSW 7 81,221,063 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCCACCCAGGACACAGTCTCATTG -3'
(R):5'- GCAAGTTGCTTTCACTAAGTGCCTC -3'

Sequencing Primer
(F):5'- GGACACAGTCTCATTGCCATTATG -3'
(R):5'- CACTAAGTGCCTCTATGTAACGGG -3'
Posted On 2013-06-11