Incidental Mutation 'R5701:Plscr5'
ID450894
Institutional Source Beutler Lab
Gene Symbol Plscr5
Ensembl Gene ENSMUSG00000095654
Gene Namephospholipid scramblase family, member 5
Synonyms
MMRRC Submission 043181-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R5701 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location92192936-92209772 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 92205511 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 178 (K178*)
Ref Sequence ENSEMBL: ENSMUSP00000136181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179751]
Predicted Effect probably null
Transcript: ENSMUST00000179751
AA Change: K178*
SMART Domains Protein: ENSMUSP00000136181
Gene: ENSMUSG00000095654
AA Change: K178*

DomainStartEndE-ValueType
Pfam:Scramblase 47 269 1.5e-79 PFAM
Meta Mutation Damage Score 0.9716 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,921,360 M727K probably benign Het
Armc8 A G 9: 99,496,149 probably null Het
Asxl1 A G 2: 153,399,489 E653G probably damaging Het
AW551984 G A 9: 39,592,822 A616V probably benign Het
Birc6 T C 17: 74,697,425 M4763T possibly damaging Het
Cand2 T G 6: 115,797,932 F1034V probably damaging Het
Ccdc80 T C 16: 45,116,378 V722A possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Chrnd G A 1: 87,197,658 V340I possibly damaging Het
Clip1 T C 5: 123,613,303 probably benign Het
Csmd3 T C 15: 47,650,221 E1920G probably damaging Het
Csmd3 A T 15: 48,540,333 F194I probably damaging Het
D930048N14Rik T A 11: 51,653,729 probably null Het
Defa28 T C 8: 21,583,847 Y89H probably benign Het
Dnah1 C T 14: 31,274,044 G2705E probably damaging Het
Eci2 A T 13: 34,990,267 S104T possibly damaging Het
Ep300 T C 15: 81,601,495 S228P unknown Het
Gabrb2 T A 11: 42,487,374 M139K probably damaging Het
Gbp4 T A 5: 105,118,399 N592I possibly damaging Het
Gpr158 C T 2: 21,746,709 R480C probably damaging Het
Gps1 A G 11: 120,785,182 D71G probably benign Het
Hoxc9 T C 15: 102,981,881 Y77H possibly damaging Het
Il9r T A 11: 32,193,263 Y231F probably benign Het
Klhl1 A G 14: 96,201,380 M494T probably benign Het
Kmt2c A G 5: 25,314,017 V2365A probably benign Het
Kri1 T A 9: 21,281,129 K241M possibly damaging Het
Macf1 A T 4: 123,503,225 C928S probably damaging Het
Mcm2 T C 6: 88,893,091 D32G probably damaging Het
Mex3d T C 10: 80,381,545 T613A probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Myh9 T C 15: 77,791,764 I241V probably benign Het
Myo6 C T 9: 80,258,527 T398I probably damaging Het
Nckap1l G A 15: 103,472,768 A366T probably benign Het
Olfr1028 A G 2: 85,951,824 T254A possibly damaging Het
Pqlc1 T A 18: 80,272,478 D118E possibly damaging Het
Rapgef6 T C 11: 54,676,394 W857R possibly damaging Het
Raxos1 G A 18: 65,937,988 probably benign Het
Rnf145 G A 11: 44,531,293 V68M possibly damaging Het
Synpo2 C G 3: 123,080,230 G1029A probably damaging Het
Tbc1d5 TTGCTGCTGCTGCTGCTGCTGGTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGGTGCTGCTGCTGCTG 17: 50,799,955 probably benign Het
Vmn2r14 T C 5: 109,219,950 Y392C probably damaging Het
Vmn2r55 A G 7: 12,670,565 F304L probably benign Het
Zfp316 C T 5: 143,254,377 G629D probably benign Het
Other mutations in Plscr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
rambler UTSW 9 92198598 missense probably benign
scrambler UTSW 9 92205511 nonsense probably null
R1710:Plscr5 UTSW 9 92205528 missense probably damaging 1.00
R2157:Plscr5 UTSW 9 92198497 missense probably benign
R4190:Plscr5 UTSW 9 92198598 missense probably benign
R5093:Plscr5 UTSW 9 92198521 missense probably benign 0.00
R5308:Plscr5 UTSW 9 92198512 missense possibly damaging 0.63
R5639:Plscr5 UTSW 9 92205511 nonsense probably null
R5693:Plscr5 UTSW 9 92205511 nonsense probably null
R5694:Plscr5 UTSW 9 92205511 nonsense probably null
R5700:Plscr5 UTSW 9 92205511 nonsense probably null
R6009:Plscr5 UTSW 9 92204435 nonsense probably null
R6091:Plscr5 UTSW 9 92204384 missense probably benign 0.15
R6303:Plscr5 UTSW 9 92205556 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CAGAGGAAATTGTCACCCTGC -3'
(R):5'- AGGGGTACATTATGATCTTGATGAC -3'

Sequencing Primer
(F):5'- CAGAAGAAAATACTGCTTTGCATCC -3'
(R):5'- CAAGAACTCGGAACCTAAG -3'
Posted On2017-01-03