Incidental Mutation 'R5712:Soga1'
ID450924
Institutional Source Beutler Lab
Gene Symbol Soga1
Ensembl Gene ENSMUSG00000055485
Gene Namesuppressor of glucose, autophagy associated 1
SynonymsD430036N24Rik, 9830001H06Rik
MMRRC Submission 043334-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #R5712 (G1)
Quality Score197
Status Not validated
Chromosome2
Chromosomal Location157015799-157079254 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 157030921 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 890 (E890V)
Ref Sequence ENSEMBL: ENSMUSP00000066556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069098]
Predicted Effect probably damaging
Transcript: ENSMUST00000069098
AA Change: E890V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066556
Gene: ENSMUSG00000055485
AA Change: E890V

DomainStartEndE-ValueType
low complexity region 15 23 N/A INTRINSIC
low complexity region 51 66 N/A INTRINSIC
low complexity region 97 112 N/A INTRINSIC
low complexity region 132 148 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
Blast:BRLZ 212 246 4e-8 BLAST
SCOP:d1fxkc_ 216 350 1e-3 SMART
Pfam:DUF3166 378 472 2.3e-31 PFAM
Pfam:DUF3166 504 593 5.3e-31 PFAM
low complexity region 637 649 N/A INTRINSIC
coiled coil region 807 867 N/A INTRINSIC
low complexity region 872 884 N/A INTRINSIC
low complexity region 938 950 N/A INTRINSIC
Pfam:DUF4482 1065 1205 3.9e-28 PFAM
low complexity region 1311 1321 N/A INTRINSIC
low complexity region 1363 1377 N/A INTRINSIC
low complexity region 1389 1418 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153229
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 145,044,753 T133A probably benign Het
Adcy8 C T 15: 64,754,866 E708K probably damaging Het
Alkbh1 A G 12: 87,429,113 C300R probably benign Het
Arhgap11a T C 2: 113,845,301 N52D probably benign Het
Ash1l T A 3: 89,051,990 S2225T probably damaging Het
Aspn A T 13: 49,563,519 Y257F probably damaging Het
Atp2b4 A C 1: 133,730,540 V544G probably damaging Het
Bclaf1 T G 10: 20,333,531 Y498D probably damaging Het
Cacna1d A G 14: 30,074,997 I1520T probably damaging Het
Cfap57 G T 4: 118,614,795 P129Q probably damaging Het
Clcn3 A G 8: 60,937,298 probably null Het
Epx A T 11: 87,874,853 Y93* probably null Het
Erich6b T A 14: 75,658,900 D75E possibly damaging Het
Exoc3l4 T A 12: 111,424,042 Y350* probably null Het
Fam13a T A 6: 58,956,699 D302V probably damaging Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Fga C T 3: 83,033,133 T698I possibly damaging Het
Fsip2 T C 2: 83,008,848 S6987P possibly damaging Het
Gatsl3 T C 11: 4,218,378 L22P probably damaging Het
Gbp9 T A 5: 105,094,555 N106I possibly damaging Het
Gls T A 1: 52,196,752 K401N probably damaging Het
Gpatch2l A G 12: 86,244,480 K146E probably damaging Het
Gpr3 A G 4: 133,210,408 S318P probably benign Het
Kbtbd7 T C 14: 79,428,765 V679A possibly damaging Het
Kcnu1 T A 8: 25,919,650 L127H probably damaging Het
Lck G T 4: 129,556,310 H214Q probably benign Het
Lrch4 A C 5: 137,637,926 S380R possibly damaging Het
Lrrk2 A T 15: 91,702,222 K414* probably null Het
Med11 A G 11: 70,453,232 E126G probably damaging Het
Mknk1 A G 4: 115,855,006 probably null Het
Mst1 T C 9: 108,082,908 C355R probably damaging Het
Myl10 T C 5: 136,694,238 F14L probably damaging Het
Nfrkb C T 9: 31,414,636 T1125M probably benign Het
Nin T C 12: 70,042,769 T1291A probably damaging Het
Pcnt T C 10: 76,429,271 Q335R probably damaging Het
Phc2 A G 4: 128,745,095 T83A probably damaging Het
Rdh19 T A 10: 127,856,887 M141K probably benign Het
Rnf17 G A 14: 56,471,399 V759I probably benign Het
Sirt7 A T 11: 120,620,851 Y18* probably null Het
Slc27a5 T C 7: 12,998,083 probably benign Het
Synpo2 T A 3: 123,121,210 I56F probably damaging Het
Tdrd6 C A 17: 43,626,408 G1250C probably damaging Het
Tmem190 G A 7: 4,784,289 G164D probably damaging Het
Tmem57 A T 4: 134,828,058 M368K probably benign Het
Tmigd1 T C 11: 76,907,032 Y67H probably damaging Het
Trim3 T A 7: 105,619,536 E70D probably damaging Het
Uap1 A G 1: 170,166,845 F21L possibly damaging Het
Vmn1r176 A T 7: 23,835,500 V76D probably benign Het
Vps13d A C 4: 145,087,173 S3245A probably benign Het
Wnt7a T C 6: 91,366,204 Y232C probably damaging Het
Zan A G 5: 137,400,098 V4224A unknown Het
Other mutations in Soga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Soga1 APN 2 157030864 missense probably damaging 1.00
IGL00924:Soga1 APN 2 157040705 missense probably damaging 0.99
IGL01723:Soga1 APN 2 157030614 missense probably benign 0.00
IGL01749:Soga1 APN 2 157021541 splice site probably benign
IGL02199:Soga1 APN 2 157030945 missense probably damaging 1.00
IGL02262:Soga1 APN 2 157030906 missense probably damaging 1.00
IGL02618:Soga1 APN 2 157040566 missense probably damaging 1.00
IGL02643:Soga1 APN 2 157040743 missense probably damaging 1.00
deglutition UTSW 2 157039864 missense possibly damaging 0.63
gulp UTSW 2 157023817 nonsense probably null
IGL02835:Soga1 UTSW 2 157041934 missense possibly damaging 0.91
R0528:Soga1 UTSW 2 157020692 missense probably damaging 1.00
R0535:Soga1 UTSW 2 157033289 missense possibly damaging 0.89
R0726:Soga1 UTSW 2 157060262 missense probably damaging 1.00
R1473:Soga1 UTSW 2 157020448 nonsense probably null
R1589:Soga1 UTSW 2 157027637 missense probably benign 0.05
R1615:Soga1 UTSW 2 157020743 missense probably damaging 1.00
R1681:Soga1 UTSW 2 157030530 missense possibly damaging 0.70
R1701:Soga1 UTSW 2 157030619 missense probably damaging 1.00
R1872:Soga1 UTSW 2 157040261 missense possibly damaging 0.88
R2056:Soga1 UTSW 2 157022827 missense probably benign 0.00
R2118:Soga1 UTSW 2 157033325 missense probably damaging 1.00
R2120:Soga1 UTSW 2 157033325 missense probably damaging 1.00
R2121:Soga1 UTSW 2 157033325 missense probably damaging 1.00
R2124:Soga1 UTSW 2 157033325 missense probably damaging 1.00
R2249:Soga1 UTSW 2 157040093 missense probably benign 0.08
R3147:Soga1 UTSW 2 157020364 missense possibly damaging 0.91
R3758:Soga1 UTSW 2 157020638 missense possibly damaging 0.77
R4601:Soga1 UTSW 2 157039924 missense probably benign 0.41
R4646:Soga1 UTSW 2 157020506 missense probably damaging 1.00
R4653:Soga1 UTSW 2 157040591 missense probably damaging 1.00
R4736:Soga1 UTSW 2 157020554 missense probably damaging 1.00
R4773:Soga1 UTSW 2 157030569 missense probably benign 0.08
R4796:Soga1 UTSW 2 157020252 missense probably benign
R4999:Soga1 UTSW 2 157022856 missense probably benign 0.10
R5304:Soga1 UTSW 2 157023817 nonsense probably null
R5369:Soga1 UTSW 2 157040734 missense probably damaging 1.00
R5530:Soga1 UTSW 2 157020342 missense probably damaging 1.00
R5780:Soga1 UTSW 2 157018490 missense probably damaging 0.98
R6162:Soga1 UTSW 2 157039864 missense possibly damaging 0.63
R6253:Soga1 UTSW 2 157021419 missense probably benign 0.00
R6303:Soga1 UTSW 2 157040764 missense possibly damaging 0.91
R6304:Soga1 UTSW 2 157040764 missense possibly damaging 0.91
R6523:Soga1 UTSW 2 157060343 nonsense probably null
R7216:Soga1 UTSW 2 157018370 missense possibly damaging 0.76
R7335:Soga1 UTSW 2 157031005 missense possibly damaging 0.86
R7562:Soga1 UTSW 2 157053589 missense probably damaging 1.00
R7593:Soga1 UTSW 2 157040856 missense probably benign 0.40
X0019:Soga1 UTSW 2 157020264 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGTGACCTACTCCCAACCAG -3'
(R):5'- GCACTTGCCATCAGTGTTCC -3'

Sequencing Primer
(F):5'- AGGCAGAACTCAGGTGCCAC -3'
(R):5'- GCCATCAGTGTTCCCCTCTAC -3'
Posted On2017-01-03