Incidental Mutation 'R5712:Fga'
ID450925
Institutional Source Beutler Lab
Gene Symbol Fga
Ensembl Gene ENSMUSG00000028001
Gene Namefibrinogen alpha chain
SynonymsENSMUSG00000059807, Fib
MMRRC Submission 043334-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.407) question?
Stock #R5712 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location83026076-83033627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 83033133 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 698 (T698I)
Ref Sequence ENSEMBL: ENSMUSP00000133117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029630] [ENSMUST00000166581]
Predicted Effect probably benign
Transcript: ENSMUST00000029630
SMART Domains Protein: ENSMUSP00000029630
Gene: ENSMUSG00000028001

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
Fib_alpha 49 193 1.29e-69 SMART
low complexity region 264 286 N/A INTRINSIC
low complexity region 311 340 N/A INTRINSIC
Pfam:Fibrinogen_aC 392 458 1.6e-33 PFAM
low complexity region 500 522 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166581
AA Change: T698I

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133117
Gene: ENSMUSG00000028001
AA Change: T698I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
Fib_alpha 49 193 1.29e-69 SMART
low complexity region 264 286 N/A INTRINSIC
low complexity region 311 340 N/A INTRINSIC
Pfam:Fibrinogen_aC 392 457 9.3e-34 PFAM
low complexity region 500 522 N/A INTRINSIC
FBG 550 786 1.43e-128 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a subunit of the coagulation factor fibrinogen, which is a component of the blood clot. The encoded protein is proteolytically processed by thrombin during the conversion of fibrinogen to fibrin. Mice lacking the encoded protein display bleeding in the peritoneal cavity, skin and soft tissues around joints immediately after birth, and are predisposed to spontaneous fatal abdominal hemorrhage as they grow. Pregnant mice lacking the encoded protein succumb to uterine bleeding during gestation. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for disruptions of this gene have blood that is unable to clot. On some genetic backgrounds this can lead to fatal hemorrhaging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 145,044,753 T133A probably benign Het
Adcy8 C T 15: 64,754,866 E708K probably damaging Het
Alkbh1 A G 12: 87,429,113 C300R probably benign Het
Arhgap11a T C 2: 113,845,301 N52D probably benign Het
Ash1l T A 3: 89,051,990 S2225T probably damaging Het
Aspn A T 13: 49,563,519 Y257F probably damaging Het
Atp2b4 A C 1: 133,730,540 V544G probably damaging Het
Bclaf1 T G 10: 20,333,531 Y498D probably damaging Het
Cacna1d A G 14: 30,074,997 I1520T probably damaging Het
Cfap57 G T 4: 118,614,795 P129Q probably damaging Het
Clcn3 A G 8: 60,937,298 probably null Het
Epx A T 11: 87,874,853 Y93* probably null Het
Erich6b T A 14: 75,658,900 D75E possibly damaging Het
Exoc3l4 T A 12: 111,424,042 Y350* probably null Het
Fam13a T A 6: 58,956,699 D302V probably damaging Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Fsip2 T C 2: 83,008,848 S6987P possibly damaging Het
Gatsl3 T C 11: 4,218,378 L22P probably damaging Het
Gbp9 T A 5: 105,094,555 N106I possibly damaging Het
Gls T A 1: 52,196,752 K401N probably damaging Het
Gpatch2l A G 12: 86,244,480 K146E probably damaging Het
Gpr3 A G 4: 133,210,408 S318P probably benign Het
Kbtbd7 T C 14: 79,428,765 V679A possibly damaging Het
Kcnu1 T A 8: 25,919,650 L127H probably damaging Het
Lck G T 4: 129,556,310 H214Q probably benign Het
Lrch4 A C 5: 137,637,926 S380R possibly damaging Het
Lrrk2 A T 15: 91,702,222 K414* probably null Het
Med11 A G 11: 70,453,232 E126G probably damaging Het
Mknk1 A G 4: 115,855,006 probably null Het
Mst1 T C 9: 108,082,908 C355R probably damaging Het
Myl10 T C 5: 136,694,238 F14L probably damaging Het
Nfrkb C T 9: 31,414,636 T1125M probably benign Het
Nin T C 12: 70,042,769 T1291A probably damaging Het
Pcnt T C 10: 76,429,271 Q335R probably damaging Het
Phc2 A G 4: 128,745,095 T83A probably damaging Het
Rdh19 T A 10: 127,856,887 M141K probably benign Het
Rnf17 G A 14: 56,471,399 V759I probably benign Het
Sirt7 A T 11: 120,620,851 Y18* probably null Het
Slc27a5 T C 7: 12,998,083 probably benign Het
Soga1 T A 2: 157,030,921 E890V probably damaging Het
Synpo2 T A 3: 123,121,210 I56F probably damaging Het
Tdrd6 C A 17: 43,626,408 G1250C probably damaging Het
Tmem190 G A 7: 4,784,289 G164D probably damaging Het
Tmem57 A T 4: 134,828,058 M368K probably benign Het
Tmigd1 T C 11: 76,907,032 Y67H probably damaging Het
Trim3 T A 7: 105,619,536 E70D probably damaging Het
Uap1 A G 1: 170,166,845 F21L possibly damaging Het
Vmn1r176 A T 7: 23,835,500 V76D probably benign Het
Vps13d A C 4: 145,087,173 S3245A probably benign Het
Wnt7a T C 6: 91,366,204 Y232C probably damaging Het
Zan A G 5: 137,400,098 V4224A unknown Het
Other mutations in Fga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Fga APN 3 83031674 missense probably damaging 1.00
IGL00478:Fga APN 3 83028644 missense probably benign 0.00
IGL00587:Fga APN 3 83030289 missense possibly damaging 0.62
IGL01289:Fga APN 3 83031245 missense possibly damaging 0.85
IGL01323:Fga APN 3 83030211 missense probably damaging 0.99
IGL01369:Fga APN 3 83030200 missense probably benign 0.00
IGL01409:Fga APN 3 83032752 missense probably damaging 1.00
IGL01541:Fga APN 3 83032707 missense probably damaging 1.00
IGL01633:Fga APN 3 83030299 missense possibly damaging 0.89
IGL01966:Fga APN 3 83029154 missense probably damaging 0.97
IGL02651:Fga APN 3 83028534 missense probably benign 0.00
IGL02822:Fga APN 3 83031482 missense probably damaging 1.00
IGL03003:Fga APN 3 83032730 missense probably damaging 1.00
R0336:Fga UTSW 3 83030857 missense probably damaging 1.00
R0540:Fga UTSW 3 83028562 missense probably damaging 1.00
R0607:Fga UTSW 3 83028562 missense probably damaging 1.00
R1471:Fga UTSW 3 83028618 missense probably benign 0.16
R1517:Fga UTSW 3 83031838 missense probably benign 0.00
R1817:Fga UTSW 3 83031775 missense probably benign 0.00
R1874:Fga UTSW 3 83032721 missense probably damaging 1.00
R2014:Fga UTSW 3 83032757 missense probably damaging 0.99
R2267:Fga UTSW 3 83032950 missense probably damaging 1.00
R2332:Fga UTSW 3 83031397 missense probably damaging 1.00
R2420:Fga UTSW 3 83033154 missense possibly damaging 0.53
R2443:Fga UTSW 3 83028541 missense probably benign 0.03
R3978:Fga UTSW 3 83030183 critical splice acceptor site probably null
R4597:Fga UTSW 3 83031235 nonsense probably null
R4644:Fga UTSW 3 83030266 missense possibly damaging 0.81
R4760:Fga UTSW 3 83031514 missense probably benign
R4867:Fga UTSW 3 83028644 missense probably benign 0.00
R5449:Fga UTSW 3 83030862 frame shift probably null
R5507:Fga UTSW 3 83033336 missense probably damaging 1.00
R6853:Fga UTSW 3 83030912 missense probably damaging 1.00
R6865:Fga UTSW 3 83031541 missense probably damaging 1.00
R7163:Fga UTSW 3 83026264 missense probably benign 0.04
R7724:Fga UTSW 3 83029125 missense probably damaging 0.99
R8153:Fga UTSW 3 83030857 missense probably damaging 1.00
R8506:Fga UTSW 3 83033316 missense probably damaging 1.00
R8511:Fga UTSW 3 83031757 nonsense probably null
X0062:Fga UTSW 3 83030271 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CGGCAGCCTGAATGACAAAG -3'
(R):5'- CTCATAGGGGCTGTTGTTCC -3'

Sequencing Primer
(F):5'- GAATTCTGGCTAGGCAATGACTACC -3'
(R):5'- TCCTGGGATCGTAGGTGCC -3'
Posted On2017-01-03