Mutagenetix > Incidental Mutation

Incidental Mutation 'R5712:Fga'

450925

Institutional Source

Beutler Lab

Gene Symbol

Fga

Ensembl Gene

ENSMUSG00000028001

Gene Name

fibrinogen alpha chain

Synonyms

ENSMUSG00000059807, Fib

MMRRC Submission

043334-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.322) question?

Stock #

R5712 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

83026076-83033627 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 83033133 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 698 (T698I)

Ref Sequence

ENSEMBL: ENSMUSP00000133117 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029630] [ENSMUST00000166581]

AlphaFold

E9PV24

Predicted Effect

probably benign
Transcript: ENSMUST00000029630

SMART Domains

Protein: ENSMUSP00000029630
Gene: ENSMUSG00000028001

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	31	43	N/A	INTRINSIC
Fib_alpha	49	193	1.29e-69	SMART
low complexity region	264	286	N/A	INTRINSIC
low complexity region	311	340	N/A	INTRINSIC
Pfam:Fibrinogen_aC	392	458	1.6e-33	PFAM
low complexity region	500	522	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166581
AA Change: T698I

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000133117
Gene: ENSMUSG00000028001
AA Change: T698I

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	31	43	N/A	INTRINSIC
Fib_alpha	49	193	1.29e-69	SMART
low complexity region	264	286	N/A	INTRINSIC
low complexity region	311	340	N/A	INTRINSIC
Pfam:Fibrinogen_aC	392	457	9.3e-34	PFAM
low complexity region	500	522	N/A	INTRINSIC
FBG	550	786	1.43e-128	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a subunit of the coagulation factor fibrinogen, which is a component of the blood clot. The encoded protein is proteolytically processed by thrombin during the conversion of fibrinogen to fibrin. Mice lacking the encoded protein display bleeding in the peritoneal cavity, skin and soft tissues around joints immediately after birth, and are predisposed to spontaneous fatal abdominal hemorrhage as they grow. Pregnant mice lacking the encoded protein succumb to uterine bleeding during gestation. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for disruptions of this gene have blood that is unable to clot. On some genetic backgrounds this can lead to fatal hemorrhaging. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700018F24Rik	A	G	5: 145,044,753	T133A	probably benign	Het
Adcy8	C	T	15: 64,754,866	E708K	probably damaging	Het
Alkbh1	A	G	12: 87,429,113	C300R	probably benign	Het
Arhgap11a	T	C	2: 113,845,301	N52D	probably benign	Het
Ash1l	T	A	3: 89,051,990	S2225T	probably damaging	Het
Aspn	A	T	13: 49,563,519	Y257F	probably damaging	Het
Atp2b4	A	C	1: 133,730,540	V544G	probably damaging	Het
Bclaf1	T	G	10: 20,333,531	Y498D	probably damaging	Het
Cacna1d	A	G	14: 30,074,997	I1520T	probably damaging	Het
Cfap57	G	T	4: 118,614,795	P129Q	probably damaging	Het
Clcn3	A	G	8: 60,937,298		probably null	Het
Epx	A	T	11: 87,874,853	Y93*	probably null	Het
Erich6b	T	A	14: 75,658,900	D75E	possibly damaging	Het
Exoc3l4	T	A	12: 111,424,042	Y350*	probably null	Het
Fam13a	T	A	6: 58,956,699	D302V	probably damaging	Het
Fbxo17	G	A	7: 28,737,472	R284H	probably damaging	Het
Fsip2	T	C	2: 83,008,848	S6987P	possibly damaging	Het
Gatsl3	T	C	11: 4,218,378	L22P	probably damaging	Het
Gbp9	T	A	5: 105,094,555	N106I	possibly damaging	Het
Gls	T	A	1: 52,196,752	K401N	probably damaging	Het
Gpatch2l	A	G	12: 86,244,480	K146E	probably damaging	Het
Gpr3	A	G	4: 133,210,408	S318P	probably benign	Het
Kbtbd7	T	C	14: 79,428,765	V679A	possibly damaging	Het
Kcnu1	T	A	8: 25,919,650	L127H	probably damaging	Het
Lck	G	T	4: 129,556,310	H214Q	probably benign	Het
Lrch4	A	C	5: 137,637,926	S380R	possibly damaging	Het
Lrrk2	A	T	15: 91,702,222	K414*	probably null	Het
Med11	A	G	11: 70,453,232	E126G	probably damaging	Het
Mknk1	A	G	4: 115,855,006		probably null	Het
Mst1	T	C	9: 108,082,908	C355R	probably damaging	Het
Myl10	T	C	5: 136,694,238	F14L	probably damaging	Het
Nfrkb	C	T	9: 31,414,636	T1125M	probably benign	Het
Nin	T	C	12: 70,042,769	T1291A	probably damaging	Het
Pcnt	T	C	10: 76,429,271	Q335R	probably damaging	Het
Phc2	A	G	4: 128,745,095	T83A	probably damaging	Het
Rdh19	T	A	10: 127,856,887	M141K	probably benign	Het
Rnf17	G	A	14: 56,471,399	V759I	probably benign	Het
Sirt7	A	T	11: 120,620,851	Y18*	probably null	Het
Slc27a5	T	C	7: 12,998,083		probably benign	Het
Soga1	T	A	2: 157,030,921	E890V	probably damaging	Het
Synpo2	T	A	3: 123,121,210	I56F	probably damaging	Het
Tdrd6	C	A	17: 43,626,408	G1250C	probably damaging	Het
Tmem190	G	A	7: 4,784,289	G164D	probably damaging	Het
Tmem57	A	T	4: 134,828,058	M368K	probably benign	Het
Tmigd1	T	C	11: 76,907,032	Y67H	probably damaging	Het
Trim3	T	A	7: 105,619,536	E70D	probably damaging	Het
Uap1	A	G	1: 170,166,845	F21L	possibly damaging	Het
Vmn1r176	A	T	7: 23,835,500	V76D	probably benign	Het
Vps13d	A	C	4: 145,087,173	S3245A	probably benign	Het
Wnt7a	T	C	6: 91,366,204	Y232C	probably damaging	Het
Zan	A	G	5: 137,400,098	V4224A	unknown	Het

Other mutations in Fga

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Fga	APN	3	83031674	missense	probably damaging	1.00
IGL00478:Fga	APN	3	83028644	missense	probably benign	0.00
IGL00587:Fga	APN	3	83030289	missense	possibly damaging	0.62
IGL01289:Fga	APN	3	83031245	missense	possibly damaging	0.85
IGL01323:Fga	APN	3	83030211	missense	probably damaging	0.99
IGL01369:Fga	APN	3	83030200	missense	probably benign	0.00
IGL01409:Fga	APN	3	83032752	missense	probably damaging	1.00
IGL01541:Fga	APN	3	83032707	missense	probably damaging	1.00
IGL01633:Fga	APN	3	83030299	missense	possibly damaging	0.89
IGL01966:Fga	APN	3	83029154	missense	probably damaging	0.97
IGL02651:Fga	APN	3	83028534	missense	probably benign	0.00
IGL02822:Fga	APN	3	83031482	missense	probably damaging	1.00
IGL03003:Fga	APN	3	83032730	missense	probably damaging	1.00
R0336:Fga	UTSW	3	83030857	missense	probably damaging	1.00
R0540:Fga	UTSW	3	83028562	missense	probably damaging	1.00
R0607:Fga	UTSW	3	83028562	missense	probably damaging	1.00
R1471:Fga	UTSW	3	83028618	missense	probably benign	0.16
R1517:Fga	UTSW	3	83031838	missense	probably benign	0.00
R1817:Fga	UTSW	3	83031775	missense	probably benign	0.00
R1874:Fga	UTSW	3	83032721	missense	probably damaging	1.00
R2014:Fga	UTSW	3	83032757	missense	probably damaging	0.99
R2267:Fga	UTSW	3	83032950	missense	probably damaging	1.00
R2332:Fga	UTSW	3	83031397	missense	probably damaging	1.00
R2420:Fga	UTSW	3	83033154	missense	possibly damaging	0.53
R2443:Fga	UTSW	3	83028541	missense	probably benign	0.03
R3978:Fga	UTSW	3	83030183	critical splice acceptor site	probably null
R4597:Fga	UTSW	3	83031235	nonsense	probably null
R4644:Fga	UTSW	3	83030266	missense	possibly damaging	0.81
R4760:Fga	UTSW	3	83031514	missense	probably benign
R4867:Fga	UTSW	3	83028644	missense	probably benign	0.00
R5449:Fga	UTSW	3	83030862	frame shift	probably null
R5507:Fga	UTSW	3	83033336	missense	probably damaging	1.00
R6853:Fga	UTSW	3	83030912	missense	probably damaging	1.00
R6865:Fga	UTSW	3	83031541	missense	probably damaging	1.00
R7163:Fga	UTSW	3	83026264	missense	probably benign	0.04
R7724:Fga	UTSW	3	83029125	missense	probably damaging	0.99
R8153:Fga	UTSW	3	83030857	missense	probably damaging	1.00
R8506:Fga	UTSW	3	83033316	missense	probably damaging	1.00
R8511:Fga	UTSW	3	83031757	nonsense	probably null
R8523:Fga	UTSW	3	83030851	missense	probably damaging	1.00
R8801:Fga	UTSW	3	83030881	missense	possibly damaging	0.89
R8906:Fga	UTSW	3	83031804	missense	probably benign	0.12
R9390:Fga	UTSW	3	83033303	missense	probably damaging	1.00
R9609:Fga	UTSW	3	83032757	missense	probably damaging	1.00
X0062:Fga	UTSW	3	83030271	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- CGGCAGCCTGAATGACAAAG -3'
(R):5'- CTCATAGGGGCTGTTGTTCC -3'

Sequencing Primer
(F):5'- GAATTCTGGCTAGGCAATGACTACC -3'
(R):5'- TCCTGGGATCGTAGGTGCC -3'

Posted On

2017-01-03