Incidental Mutation 'R5712:Cfap57'
ID 450929
Institutional Source Beutler Lab
Gene Symbol Cfap57
Ensembl Gene ENSMUSG00000028730
Gene Name cilia and flagella associated protein 57
Synonyms LOC384050, Wdr65, 1110020C03Rik, C130004B06Rik
MMRRC Submission 043334-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5712 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 118411748-118477974 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 118471992 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Glutamine at position 129 (P129Q)
Ref Sequence ENSEMBL: ENSMUSP00000080592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071972] [ENSMUST00000081921]
AlphaFold Q9D180
Predicted Effect probably damaging
Transcript: ENSMUST00000071972
AA Change: P129Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071863
Gene: ENSMUSG00000028730
AA Change: P129Q

DomainStartEndE-ValueType
Blast:WD40 44 88 3e-12 BLAST
Blast:WD40 95 137 1e-9 BLAST
WD40 140 181 1.77e2 SMART
internal_repeat_1 182 237 7.23e-5 PROSPERO
WD40 329 365 1.27e2 SMART
WD40 376 416 3.4e-2 SMART
WD40 418 456 1.59e1 SMART
Blast:WD40 461 497 4e-18 BLAST
WD40 500 539 9.67e-7 SMART
WD40 544 581 3.96e1 SMART
Blast:WD40 582 621 8e-16 BLAST
WD40 626 665 3.21e-1 SMART
coiled coil region 690 1056 N/A INTRINSIC
coiled coil region 1094 1166 N/A INTRINSIC
coiled coil region 1197 1222 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000081921
AA Change: P129Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080592
Gene: ENSMUSG00000028730
AA Change: P129Q

DomainStartEndE-ValueType
Blast:WD40 44 88 3e-12 BLAST
Blast:WD40 95 137 1e-9 BLAST
WD40 140 181 1.77e2 SMART
internal_repeat_1 182 237 7.23e-5 PROSPERO
WD40 329 365 1.27e2 SMART
WD40 376 416 3.4e-2 SMART
WD40 418 456 1.59e1 SMART
Blast:WD40 461 497 4e-18 BLAST
WD40 500 539 9.67e-7 SMART
WD40 544 581 3.96e1 SMART
Blast:WD40 582 621 8e-16 BLAST
WD40 626 665 3.21e-1 SMART
coiled coil region 690 1056 N/A INTRINSIC
coiled coil region 1094 1166 N/A INTRINSIC
coiled coil region 1197 1222 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member is thought to function in craniofacial development, possibly in the fusion of lip and palate. A missense mutation in this gene is associated with Van der Woude syndrome 2. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 144,981,563 (GRCm39) T133A probably benign Het
Adcy8 C T 15: 64,626,715 (GRCm39) E708K probably damaging Het
Alkbh1 A G 12: 87,475,883 (GRCm39) C300R probably benign Het
Arhgap11a T C 2: 113,675,646 (GRCm39) N52D probably benign Het
Ash1l T A 3: 88,959,297 (GRCm39) S2225T probably damaging Het
Aspn A T 13: 49,716,995 (GRCm39) Y257F probably damaging Het
Atp2b4 A C 1: 133,658,278 (GRCm39) V544G probably damaging Het
Bclaf1 T G 10: 20,209,277 (GRCm39) Y498D probably damaging Het
Cacna1d A G 14: 29,796,954 (GRCm39) I1520T probably damaging Het
Castor1 T C 11: 4,168,378 (GRCm39) L22P probably damaging Het
Clcn3 A G 8: 61,390,332 (GRCm39) probably null Het
Epx A T 11: 87,765,679 (GRCm39) Y93* probably null Het
Erich6b T A 14: 75,896,340 (GRCm39) D75E possibly damaging Het
Exoc3l4 T A 12: 111,390,476 (GRCm39) Y350* probably null Het
Fam13a T A 6: 58,933,684 (GRCm39) D302V probably damaging Het
Fbxo17 G A 7: 28,436,897 (GRCm39) R284H probably damaging Het
Fga C T 3: 82,940,440 (GRCm39) T698I possibly damaging Het
Fsip2 T C 2: 82,839,192 (GRCm39) S6987P possibly damaging Het
Gbp9 T A 5: 105,242,421 (GRCm39) N106I possibly damaging Het
Gls T A 1: 52,235,911 (GRCm39) K401N probably damaging Het
Gpatch2l A G 12: 86,291,254 (GRCm39) K146E probably damaging Het
Gpr3 A G 4: 132,937,719 (GRCm39) S318P probably benign Het
Kbtbd7 T C 14: 79,666,205 (GRCm39) V679A possibly damaging Het
Kcnu1 T A 8: 26,409,678 (GRCm39) L127H probably damaging Het
Lck G T 4: 129,450,103 (GRCm39) H214Q probably benign Het
Lrch4 A C 5: 137,636,188 (GRCm39) S380R possibly damaging Het
Lrrk2 A T 15: 91,586,425 (GRCm39) K414* probably null Het
Maco1 A T 4: 134,555,369 (GRCm39) M368K probably benign Het
Med11 A G 11: 70,344,058 (GRCm39) E126G probably damaging Het
Mknk1 A G 4: 115,712,203 (GRCm39) probably null Het
Mst1 T C 9: 107,960,107 (GRCm39) C355R probably damaging Het
Mtcl2 T A 2: 156,872,841 (GRCm39) E890V probably damaging Het
Myl10 T C 5: 136,723,092 (GRCm39) F14L probably damaging Het
Nfrkb C T 9: 31,325,932 (GRCm39) T1125M probably benign Het
Nin T C 12: 70,089,543 (GRCm39) T1291A probably damaging Het
Pcnt T C 10: 76,265,105 (GRCm39) Q335R probably damaging Het
Phc2 A G 4: 128,638,888 (GRCm39) T83A probably damaging Het
Rdh19 T A 10: 127,692,756 (GRCm39) M141K probably benign Het
Rnf17 G A 14: 56,708,856 (GRCm39) V759I probably benign Het
Sirt7 A T 11: 120,511,677 (GRCm39) Y18* probably null Het
Slc27a5 T C 7: 12,732,010 (GRCm39) probably benign Het
Synpo2 T A 3: 122,914,859 (GRCm39) I56F probably damaging Het
Tdrd6 C A 17: 43,937,299 (GRCm39) G1250C probably damaging Het
Tmem190 G A 7: 4,787,288 (GRCm39) G164D probably damaging Het
Tmigd1 T C 11: 76,797,858 (GRCm39) Y67H probably damaging Het
Trim3 T A 7: 105,268,743 (GRCm39) E70D probably damaging Het
Uap1 A G 1: 169,994,414 (GRCm39) F21L possibly damaging Het
Vmn1r176 A T 7: 23,534,925 (GRCm39) V76D probably benign Het
Vps13d A C 4: 144,813,743 (GRCm39) S3245A probably benign Het
Wnt7a T C 6: 91,343,186 (GRCm39) Y232C probably damaging Het
Zan A G 5: 137,398,360 (GRCm39) V4224A unknown Het
Other mutations in Cfap57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Cfap57 APN 4 118,438,198 (GRCm39) missense probably benign 0.01
IGL00508:Cfap57 APN 4 118,438,367 (GRCm39) splice site probably null
IGL00857:Cfap57 APN 4 118,470,120 (GRCm39) critical splice donor site probably null
IGL01147:Cfap57 APN 4 118,446,198 (GRCm39) missense probably damaging 0.97
IGL01396:Cfap57 APN 4 118,467,792 (GRCm39) missense probably damaging 1.00
IGL01420:Cfap57 APN 4 118,470,137 (GRCm39) missense probably benign 0.21
IGL01615:Cfap57 APN 4 118,457,993 (GRCm39) missense probably damaging 1.00
IGL02154:Cfap57 APN 4 118,470,214 (GRCm39) missense probably damaging 1.00
IGL02161:Cfap57 APN 4 118,436,569 (GRCm39) missense possibly damaging 0.75
IGL02481:Cfap57 APN 4 118,438,302 (GRCm39) missense probably damaging 1.00
IGL02483:Cfap57 APN 4 118,438,302 (GRCm39) missense probably damaging 1.00
IGL02503:Cfap57 APN 4 118,426,545 (GRCm39) critical splice donor site probably null
IGL02800:Cfap57 APN 4 118,471,947 (GRCm39) missense probably damaging 1.00
IGL03083:Cfap57 APN 4 118,441,936 (GRCm39) missense probably damaging 0.96
IGL03146:Cfap57 APN 4 118,456,216 (GRCm39) missense probably damaging 1.00
IGL03246:Cfap57 APN 4 118,433,842 (GRCm39) missense probably benign 0.29
IGL03376:Cfap57 APN 4 118,441,917 (GRCm39) missense probably damaging 0.96
G1Funyon:Cfap57 UTSW 4 118,450,271 (GRCm39) missense possibly damaging 0.94
R0144:Cfap57 UTSW 4 118,441,902 (GRCm39) missense probably damaging 1.00
R0184:Cfap57 UTSW 4 118,456,209 (GRCm39) missense probably damaging 1.00
R0415:Cfap57 UTSW 4 118,426,628 (GRCm39) missense possibly damaging 0.89
R0515:Cfap57 UTSW 4 118,477,599 (GRCm39) missense probably damaging 1.00
R0690:Cfap57 UTSW 4 118,426,924 (GRCm39) splice site probably benign
R0730:Cfap57 UTSW 4 118,470,117 (GRCm39) splice site probably null
R0737:Cfap57 UTSW 4 118,438,299 (GRCm39) missense possibly damaging 0.81
R0854:Cfap57 UTSW 4 118,419,069 (GRCm39) missense probably benign 0.04
R0880:Cfap57 UTSW 4 118,439,035 (GRCm39) nonsense probably null
R1085:Cfap57 UTSW 4 118,452,976 (GRCm39) missense probably benign 0.20
R1119:Cfap57 UTSW 4 118,463,873 (GRCm39) nonsense probably null
R1217:Cfap57 UTSW 4 118,463,849 (GRCm39) missense possibly damaging 0.67
R1294:Cfap57 UTSW 4 118,463,731 (GRCm39) critical splice donor site probably null
R1487:Cfap57 UTSW 4 118,471,978 (GRCm39) missense probably benign 0.01
R1676:Cfap57 UTSW 4 118,453,137 (GRCm39) missense probably damaging 1.00
R1688:Cfap57 UTSW 4 118,426,843 (GRCm39) missense probably null 0.20
R1709:Cfap57 UTSW 4 118,428,901 (GRCm39) missense probably benign 0.00
R1719:Cfap57 UTSW 4 118,463,828 (GRCm39) missense probably benign 0.04
R1782:Cfap57 UTSW 4 118,472,172 (GRCm39) missense probably damaging 0.98
R1791:Cfap57 UTSW 4 118,428,921 (GRCm39) missense possibly damaging 0.66
R1850:Cfap57 UTSW 4 118,457,091 (GRCm39) missense probably damaging 1.00
R1866:Cfap57 UTSW 4 118,457,124 (GRCm39) missense possibly damaging 0.49
R1912:Cfap57 UTSW 4 118,472,207 (GRCm39) missense probably damaging 0.96
R1978:Cfap57 UTSW 4 118,450,329 (GRCm39) missense probably benign 0.03
R2177:Cfap57 UTSW 4 118,463,885 (GRCm39) missense probably benign 0.00
R2322:Cfap57 UTSW 4 118,467,922 (GRCm39) missense probably benign
R3905:Cfap57 UTSW 4 118,453,036 (GRCm39) missense probably damaging 1.00
R4013:Cfap57 UTSW 4 118,450,340 (GRCm39) missense probably benign 0.01
R4079:Cfap57 UTSW 4 118,456,194 (GRCm39) missense probably benign 0.34
R4962:Cfap57 UTSW 4 118,470,262 (GRCm39) missense probably benign 0.21
R4970:Cfap57 UTSW 4 118,477,568 (GRCm39) missense probably damaging 0.99
R4974:Cfap57 UTSW 4 118,450,251 (GRCm39) missense probably damaging 1.00
R4999:Cfap57 UTSW 4 118,453,045 (GRCm39) missense probably benign 0.01
R5482:Cfap57 UTSW 4 118,426,838 (GRCm39) missense probably benign
R5522:Cfap57 UTSW 4 118,453,085 (GRCm39) missense probably benign 0.41
R5626:Cfap57 UTSW 4 118,471,980 (GRCm39) missense probably damaging 1.00
R5685:Cfap57 UTSW 4 118,426,656 (GRCm39) missense probably benign
R5961:Cfap57 UTSW 4 118,428,942 (GRCm39) missense probably benign 0.00
R6244:Cfap57 UTSW 4 118,436,607 (GRCm39) missense probably damaging 0.99
R6268:Cfap57 UTSW 4 118,426,648 (GRCm39) nonsense probably null
R6271:Cfap57 UTSW 4 118,452,956 (GRCm39) missense probably benign 0.13
R6330:Cfap57 UTSW 4 118,426,593 (GRCm39) missense probably benign
R6439:Cfap57 UTSW 4 118,446,172 (GRCm39) critical splice donor site probably null
R6639:Cfap57 UTSW 4 118,411,909 (GRCm39) missense probably benign 0.13
R6722:Cfap57 UTSW 4 118,441,914 (GRCm39) missense probably damaging 1.00
R7033:Cfap57 UTSW 4 118,470,323 (GRCm39) missense possibly damaging 0.67
R7143:Cfap57 UTSW 4 118,477,906 (GRCm39) unclassified probably benign
R7162:Cfap57 UTSW 4 118,472,128 (GRCm39) missense probably benign
R7174:Cfap57 UTSW 4 118,446,264 (GRCm39) missense probably benign 0.35
R7210:Cfap57 UTSW 4 118,433,900 (GRCm39) nonsense probably null
R7242:Cfap57 UTSW 4 118,450,293 (GRCm39) missense possibly damaging 0.50
R7244:Cfap57 UTSW 4 118,411,997 (GRCm39) nonsense probably null
R7359:Cfap57 UTSW 4 118,456,162 (GRCm39) missense probably benign 0.01
R7373:Cfap57 UTSW 4 118,472,128 (GRCm39) missense probably benign
R7394:Cfap57 UTSW 4 118,450,334 (GRCm39) missense probably benign 0.00
R7401:Cfap57 UTSW 4 118,472,128 (GRCm39) missense probably benign
R7412:Cfap57 UTSW 4 118,472,128 (GRCm39) missense probably benign
R7414:Cfap57 UTSW 4 118,472,128 (GRCm39) missense probably benign
R7452:Cfap57 UTSW 4 118,452,981 (GRCm39) missense probably damaging 1.00
R7457:Cfap57 UTSW 4 118,446,198 (GRCm39) missense probably damaging 0.97
R7559:Cfap57 UTSW 4 118,472,128 (GRCm39) missense probably benign
R7642:Cfap57 UTSW 4 118,472,128 (GRCm39) missense probably benign
R7741:Cfap57 UTSW 4 118,472,128 (GRCm39) missense probably benign
R7744:Cfap57 UTSW 4 118,472,128 (GRCm39) missense probably benign
R7745:Cfap57 UTSW 4 118,472,128 (GRCm39) missense probably benign
R7842:Cfap57 UTSW 4 118,411,952 (GRCm39) nonsense probably null
R7936:Cfap57 UTSW 4 118,472,128 (GRCm39) missense probably benign
R7940:Cfap57 UTSW 4 118,472,128 (GRCm39) missense probably benign
R7942:Cfap57 UTSW 4 118,472,128 (GRCm39) missense probably benign
R8074:Cfap57 UTSW 4 118,426,822 (GRCm39) missense possibly damaging 0.66
R8301:Cfap57 UTSW 4 118,450,271 (GRCm39) missense possibly damaging 0.94
R8411:Cfap57 UTSW 4 118,472,128 (GRCm39) missense probably benign
R8447:Cfap57 UTSW 4 118,472,128 (GRCm39) missense probably benign
R8491:Cfap57 UTSW 4 118,472,128 (GRCm39) missense probably benign
R8524:Cfap57 UTSW 4 118,472,128 (GRCm39) missense probably benign
R8670:Cfap57 UTSW 4 118,472,122 (GRCm39) missense possibly damaging 0.91
R8707:Cfap57 UTSW 4 118,450,203 (GRCm39) missense probably benign 0.04
R8790:Cfap57 UTSW 4 118,439,111 (GRCm39) missense possibly damaging 0.59
R8941:Cfap57 UTSW 4 118,426,799 (GRCm39) missense probably damaging 0.99
R9139:Cfap57 UTSW 4 118,412,048 (GRCm39) missense probably benign 0.02
R9212:Cfap57 UTSW 4 118,436,649 (GRCm39) missense possibly damaging 0.95
R9442:Cfap57 UTSW 4 118,463,731 (GRCm39) critical splice donor site probably null
R9525:Cfap57 UTSW 4 118,433,778 (GRCm39) missense probably damaging 1.00
X0022:Cfap57 UTSW 4 118,471,942 (GRCm39) missense probably benign
Z1088:Cfap57 UTSW 4 118,439,079 (GRCm39) missense probably benign 0.22
Z1177:Cfap57 UTSW 4 118,456,153 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTAAGTTCTAATCAGCACCGC -3'
(R):5'- CTATCTCCGAGACTGTGCAAG -3'

Sequencing Primer
(F):5'- TCTAACCCGTGCCTGGAAAGTAG -3'
(R):5'- GAAAAACCGGCCGTCACTATTTATG -3'
Posted On 2017-01-03