Incidental Mutation 'R5712:Lck'
ID 450931
Institutional Source Beutler Lab
Gene Symbol Lck
Ensembl Gene ENSMUSG00000000409
Gene Name lymphocyte protein tyrosine kinase
Synonyms Hck-3, p56
MMRRC Submission 043334-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5712 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 129442142-129467415 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 129450103 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 214 (H214Q)
Ref Sequence ENSEMBL: ENSMUSP00000125777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067240] [ENSMUST00000102596] [ENSMUST00000134336] [ENSMUST00000167288]
AlphaFold P06240
Predicted Effect probably benign
Transcript: ENSMUST00000067240
AA Change: H203Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066209
Gene: ENSMUSG00000000409
AA Change: H203Q

DomainStartEndE-ValueType
SH3 64 120 3.53e-17 SMART
SH2 125 215 2.07e-34 SMART
TyrKc 245 494 2.66e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102596
AA Change: H203Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099656
Gene: ENSMUSG00000000409
AA Change: H203Q

DomainStartEndE-ValueType
SH3 64 120 3.53e-17 SMART
SH2 125 215 2.07e-34 SMART
TyrKc 245 494 2.66e-133 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123640
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132030
Predicted Effect probably benign
Transcript: ENSMUST00000134336
SMART Domains Protein: ENSMUSP00000119263
Gene: ENSMUSG00000000409

DomainStartEndE-ValueType
PDB:1Q69|B 7 33 9e-12 PDB
SCOP:d1awj__ 45 92 2e-8 SMART
PDB:1LCK|A 53 92 3e-20 PDB
Blast:SH3 64 92 4e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139957
Predicted Effect probably benign
Transcript: ENSMUST00000167288
AA Change: H214Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125777
Gene: ENSMUSG00000000409
AA Change: H214Q

DomainStartEndE-ValueType
SH3 75 131 3.53e-17 SMART
SH2 136 226 2.07e-34 SMART
TyrKc 256 505 2.66e-133 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183371
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Src family of protein tyrosine kinases (PTKs). The encoded protein is a key signaling molecule in the selection and maturation of developing T-cells. It contains N-terminal sites for myristylation and palmitylation, a PTK domain, and SH2 and SH3 domains which are involved in mediating protein-protein interactions with phosphotyrosine-containing and proline-rich motifs, respectively. The protein localizes to the plasma membrane and pericentrosomal vesicles, and binds to cell surface receptors, including CD4 and CD8, and other signaling molecules. Multiple alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for mutations of this gene exhibit thymic atrophy with reduced numbers of peripheral T cells. Null mutants have few double positive and no mature single positive (SP) thymocytes. A hypomorph has decreased expression of CD3epsilon chain onSP thymocytes, whose numbers are reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 144,981,563 (GRCm39) T133A probably benign Het
Adcy8 C T 15: 64,626,715 (GRCm39) E708K probably damaging Het
Alkbh1 A G 12: 87,475,883 (GRCm39) C300R probably benign Het
Arhgap11a T C 2: 113,675,646 (GRCm39) N52D probably benign Het
Ash1l T A 3: 88,959,297 (GRCm39) S2225T probably damaging Het
Aspn A T 13: 49,716,995 (GRCm39) Y257F probably damaging Het
Atp2b4 A C 1: 133,658,278 (GRCm39) V544G probably damaging Het
Bclaf1 T G 10: 20,209,277 (GRCm39) Y498D probably damaging Het
Cacna1d A G 14: 29,796,954 (GRCm39) I1520T probably damaging Het
Castor1 T C 11: 4,168,378 (GRCm39) L22P probably damaging Het
Cfap57 G T 4: 118,471,992 (GRCm39) P129Q probably damaging Het
Clcn3 A G 8: 61,390,332 (GRCm39) probably null Het
Epx A T 11: 87,765,679 (GRCm39) Y93* probably null Het
Erich6b T A 14: 75,896,340 (GRCm39) D75E possibly damaging Het
Exoc3l4 T A 12: 111,390,476 (GRCm39) Y350* probably null Het
Fam13a T A 6: 58,933,684 (GRCm39) D302V probably damaging Het
Fbxo17 G A 7: 28,436,897 (GRCm39) R284H probably damaging Het
Fga C T 3: 82,940,440 (GRCm39) T698I possibly damaging Het
Fsip2 T C 2: 82,839,192 (GRCm39) S6987P possibly damaging Het
Gbp9 T A 5: 105,242,421 (GRCm39) N106I possibly damaging Het
Gls T A 1: 52,235,911 (GRCm39) K401N probably damaging Het
Gpatch2l A G 12: 86,291,254 (GRCm39) K146E probably damaging Het
Gpr3 A G 4: 132,937,719 (GRCm39) S318P probably benign Het
Kbtbd7 T C 14: 79,666,205 (GRCm39) V679A possibly damaging Het
Kcnu1 T A 8: 26,409,678 (GRCm39) L127H probably damaging Het
Lrch4 A C 5: 137,636,188 (GRCm39) S380R possibly damaging Het
Lrrk2 A T 15: 91,586,425 (GRCm39) K414* probably null Het
Maco1 A T 4: 134,555,369 (GRCm39) M368K probably benign Het
Med11 A G 11: 70,344,058 (GRCm39) E126G probably damaging Het
Mknk1 A G 4: 115,712,203 (GRCm39) probably null Het
Mst1 T C 9: 107,960,107 (GRCm39) C355R probably damaging Het
Mtcl2 T A 2: 156,872,841 (GRCm39) E890V probably damaging Het
Myl10 T C 5: 136,723,092 (GRCm39) F14L probably damaging Het
Nfrkb C T 9: 31,325,932 (GRCm39) T1125M probably benign Het
Nin T C 12: 70,089,543 (GRCm39) T1291A probably damaging Het
Pcnt T C 10: 76,265,105 (GRCm39) Q335R probably damaging Het
Phc2 A G 4: 128,638,888 (GRCm39) T83A probably damaging Het
Rdh19 T A 10: 127,692,756 (GRCm39) M141K probably benign Het
Rnf17 G A 14: 56,708,856 (GRCm39) V759I probably benign Het
Sirt7 A T 11: 120,511,677 (GRCm39) Y18* probably null Het
Slc27a5 T C 7: 12,732,010 (GRCm39) probably benign Het
Synpo2 T A 3: 122,914,859 (GRCm39) I56F probably damaging Het
Tdrd6 C A 17: 43,937,299 (GRCm39) G1250C probably damaging Het
Tmem190 G A 7: 4,787,288 (GRCm39) G164D probably damaging Het
Tmigd1 T C 11: 76,797,858 (GRCm39) Y67H probably damaging Het
Trim3 T A 7: 105,268,743 (GRCm39) E70D probably damaging Het
Uap1 A G 1: 169,994,414 (GRCm39) F21L possibly damaging Het
Vmn1r176 A T 7: 23,534,925 (GRCm39) V76D probably benign Het
Vps13d A C 4: 144,813,743 (GRCm39) S3245A probably benign Het
Wnt7a T C 6: 91,343,186 (GRCm39) Y232C probably damaging Het
Zan A G 5: 137,398,360 (GRCm39) V4224A unknown Het
Other mutations in Lck
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01824:Lck APN 4 129,451,939 (GRCm39) missense probably benign 0.00
IGL02666:Lck APN 4 129,450,212 (GRCm39) missense probably damaging 0.98
iconoclast UTSW 4 129,449,397 (GRCm39) missense probably damaging 1.00
lockdown UTSW 4 129,451,920 (GRCm39) missense probably damaging 1.00
stromberg UTSW 4 129,449,433 (GRCm39) missense probably damaging 1.00
studentenkarzer UTSW 4 129,450,098 (GRCm39) missense probably damaging 1.00
swan UTSW 4 129,449,433 (GRCm39) missense probably damaging 1.00
R0091:Lck UTSW 4 129,449,474 (GRCm39) missense possibly damaging 0.88
R0480:Lck UTSW 4 129,449,433 (GRCm39) missense probably damaging 1.00
R1013:Lck UTSW 4 129,451,920 (GRCm39) missense probably damaging 1.00
R1510:Lck UTSW 4 129,449,461 (GRCm39) missense possibly damaging 0.92
R1569:Lck UTSW 4 129,449,449 (GRCm39) missense probably damaging 0.98
R1845:Lck UTSW 4 129,451,879 (GRCm39) missense probably benign 0.00
R2001:Lck UTSW 4 129,442,730 (GRCm39) missense probably benign 0.00
R2141:Lck UTSW 4 129,442,713 (GRCm39) missense probably damaging 1.00
R4694:Lck UTSW 4 129,442,765 (GRCm39) missense possibly damaging 0.66
R4737:Lck UTSW 4 129,449,777 (GRCm39) missense possibly damaging 0.93
R5706:Lck UTSW 4 129,445,431 (GRCm39) critical splice acceptor site probably null
R7023:Lck UTSW 4 129,442,658 (GRCm39) missense possibly damaging 0.89
R7411:Lck UTSW 4 129,445,763 (GRCm39) missense probably benign 0.02
R9044:Lck UTSW 4 129,450,098 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCATTCAACATTAGCCGGC -3'
(R):5'- ACCTGATTTATGGAAGGCAATCCG -3'

Sequencing Primer
(F):5'- CAGGGTCTAGGGTCAGGTTCTATAC -3'
(R):5'- GCAATCCGCCACATTTTCTTTTTC -3'
Posted On 2017-01-03