Incidental Mutation 'R5712:Gpr3'
ID450932
Institutional Source Beutler Lab
Gene Symbol Gpr3
Ensembl Gene ENSMUSG00000049649
Gene NameG-protein coupled receptor 3
SynonymsGpcr3, Gpcr21
MMRRC Submission 043334-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R5712 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location133209340-133212536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 133210408 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 318 (S318P)
Ref Sequence ENSEMBL: ENSMUSP00000101531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052090] [ENSMUST00000105911] [ENSMUST00000151025]
Predicted Effect probably benign
Transcript: ENSMUST00000052090
AA Change: S318P

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000062083
Gene: ENSMUSG00000049649
AA Change: S318P

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Pfam:7tm_1 57 297 2.4e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105911
AA Change: S318P

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000101531
Gene: ENSMUSG00000049649
AA Change: S318P

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Pfam:7tm_1 57 297 2e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150744
Predicted Effect probably benign
Transcript: ENSMUST00000151025
SMART Domains Protein: ENSMUSP00000116032
Gene: ENSMUSG00000049649

DomainStartEndE-ValueType
SCOP:d1l9ha_ 20 95 3e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218998
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the G protein-coupled receptor family and is found in the cell membrane. G protein-coupled receptors, characterized by a seven transmembrane domain motif, are involved in translating outside signals into G protein mediated intracellular effects. The encoded protein activates adenylate cyclase and modulates amyloid-beta production in a mouse model, suggesting that it may play a role in Alzheimer's disease. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for one allele display an increased thermal nociceptive threshold while females homozygous for another allele display age-related reproductive failure due to ovulation of a progressively increasing proportion of developmentally incompetent oocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 145,044,753 T133A probably benign Het
Adcy8 C T 15: 64,754,866 E708K probably damaging Het
Alkbh1 A G 12: 87,429,113 C300R probably benign Het
Arhgap11a T C 2: 113,845,301 N52D probably benign Het
Ash1l T A 3: 89,051,990 S2225T probably damaging Het
Aspn A T 13: 49,563,519 Y257F probably damaging Het
Atp2b4 A C 1: 133,730,540 V544G probably damaging Het
Bclaf1 T G 10: 20,333,531 Y498D probably damaging Het
Cacna1d A G 14: 30,074,997 I1520T probably damaging Het
Cfap57 G T 4: 118,614,795 P129Q probably damaging Het
Clcn3 A G 8: 60,937,298 probably null Het
Epx A T 11: 87,874,853 Y93* probably null Het
Erich6b T A 14: 75,658,900 D75E possibly damaging Het
Exoc3l4 T A 12: 111,424,042 Y350* probably null Het
Fam13a T A 6: 58,956,699 D302V probably damaging Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Fga C T 3: 83,033,133 T698I possibly damaging Het
Fsip2 T C 2: 83,008,848 S6987P possibly damaging Het
Gatsl3 T C 11: 4,218,378 L22P probably damaging Het
Gbp9 T A 5: 105,094,555 N106I possibly damaging Het
Gls T A 1: 52,196,752 K401N probably damaging Het
Gpatch2l A G 12: 86,244,480 K146E probably damaging Het
Kbtbd7 T C 14: 79,428,765 V679A possibly damaging Het
Kcnu1 T A 8: 25,919,650 L127H probably damaging Het
Lck G T 4: 129,556,310 H214Q probably benign Het
Lrch4 A C 5: 137,637,926 S380R possibly damaging Het
Lrrk2 A T 15: 91,702,222 K414* probably null Het
Med11 A G 11: 70,453,232 E126G probably damaging Het
Mknk1 A G 4: 115,855,006 probably null Het
Mst1 T C 9: 108,082,908 C355R probably damaging Het
Myl10 T C 5: 136,694,238 F14L probably damaging Het
Nfrkb C T 9: 31,414,636 T1125M probably benign Het
Nin T C 12: 70,042,769 T1291A probably damaging Het
Pcnt T C 10: 76,429,271 Q335R probably damaging Het
Phc2 A G 4: 128,745,095 T83A probably damaging Het
Rdh19 T A 10: 127,856,887 M141K probably benign Het
Rnf17 G A 14: 56,471,399 V759I probably benign Het
Sirt7 A T 11: 120,620,851 Y18* probably null Het
Slc27a5 T C 7: 12,998,083 probably benign Het
Soga1 T A 2: 157,030,921 E890V probably damaging Het
Synpo2 T A 3: 123,121,210 I56F probably damaging Het
Tdrd6 C A 17: 43,626,408 G1250C probably damaging Het
Tmem190 G A 7: 4,784,289 G164D probably damaging Het
Tmem57 A T 4: 134,828,058 M368K probably benign Het
Tmigd1 T C 11: 76,907,032 Y67H probably damaging Het
Trim3 T A 7: 105,619,536 E70D probably damaging Het
Uap1 A G 1: 170,166,845 F21L possibly damaging Het
Vmn1r176 A T 7: 23,835,500 V76D probably benign Het
Vps13d A C 4: 145,087,173 S3245A probably benign Het
Wnt7a T C 6: 91,366,204 Y232C probably damaging Het
Zan A G 5: 137,400,098 V4224A unknown Het
Other mutations in Gpr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02424:Gpr3 APN 4 133211094 missense probably damaging 1.00
IGL02974:Gpr3 APN 4 133210909 missense possibly damaging 0.90
R0095:Gpr3 UTSW 4 133211286 missense probably benign 0.01
R0532:Gpr3 UTSW 4 133210485 missense probably damaging 1.00
R1831:Gpr3 UTSW 4 133211143 missense possibly damaging 0.80
R2127:Gpr3 UTSW 4 133210621 missense probably damaging 0.96
R4077:Gpr3 UTSW 4 133210915 missense probably damaging 1.00
R4078:Gpr3 UTSW 4 133210915 missense probably damaging 1.00
R5306:Gpr3 UTSW 4 133211179 missense probably damaging 1.00
R5602:Gpr3 UTSW 4 133210494 missense probably damaging 1.00
R5913:Gpr3 UTSW 4 133211178 missense probably damaging 1.00
R7434:Gpr3 UTSW 4 133211137 missense probably benign 0.45
R7645:Gpr3 UTSW 4 133211329 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACATTCTAGAGCCACGCG -3'
(R):5'- AGCTCTATGCCCAGATCTGC -3'

Sequencing Primer
(F):5'- ATTCTAGAGCCACGCGGTCAG -3'
(R):5'- AGATCTGCCGCATCGTCTG -3'
Posted On2017-01-03