Incidental Mutation 'R5712:Myl10'
ID450939
Institutional Source Beutler Lab
Gene Symbol Myl10
Ensembl Gene ENSMUSG00000005474
Gene Namemyosin, light chain 10, regulatory
SynonymsPLRLC-C, 1700027I08Rik, PLRLC, PLRLC-A, Mylc2pl, PLRLC-B
MMRRC Submission 043334-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5712 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location136693146-136701094 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136694238 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 14 (F14L)
Ref Sequence ENSEMBL: ENSMUSP00000142570 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005611] [ENSMUST00000196068] [ENSMUST00000196436] [ENSMUST00000197186]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005611
AA Change: F14L

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000005611
Gene: ENSMUSG00000005474
AA Change: F14L

DomainStartEndE-ValueType
EFh 9 37 1.5e-5 SMART
EFh 79 107 3.16e1 SMART
Blast:EFh 115 143 6e-14 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000196068
AA Change: F14L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142570
Gene: ENSMUSG00000005474
AA Change: F14L

DomainStartEndE-ValueType
Pfam:EF-hand_1 9 37 9.4e-7 PFAM
Pfam:EF-hand_6 9 40 9.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196436
SMART Domains Protein: ENSMUSP00000142495
Gene: ENSMUSG00000005474

DomainStartEndE-ValueType
Pfam:EF-hand_6 1 24 5.4e-3 PFAM
Pfam:EF-hand_8 5 39 1.3e-3 PFAM
Blast:EFh 63 91 1e-11 BLAST
Blast:EFh 99 127 4e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000197186
SMART Domains Protein: ENSMUSP00000143165
Gene: ENSMUSG00000005474

DomainStartEndE-ValueType
Pfam:EF-hand_6 1 24 5.4e-3 PFAM
Pfam:EF-hand_8 5 39 1.3e-3 PFAM
Blast:EFh 63 91 1e-11 BLAST
Blast:EFh 99 127 4e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197849
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199074
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 145,044,753 T133A probably benign Het
Adcy8 C T 15: 64,754,866 E708K probably damaging Het
Alkbh1 A G 12: 87,429,113 C300R probably benign Het
Arhgap11a T C 2: 113,845,301 N52D probably benign Het
Ash1l T A 3: 89,051,990 S2225T probably damaging Het
Aspn A T 13: 49,563,519 Y257F probably damaging Het
Atp2b4 A C 1: 133,730,540 V544G probably damaging Het
Bclaf1 T G 10: 20,333,531 Y498D probably damaging Het
Cacna1d A G 14: 30,074,997 I1520T probably damaging Het
Cfap57 G T 4: 118,614,795 P129Q probably damaging Het
Clcn3 A G 8: 60,937,298 probably null Het
Epx A T 11: 87,874,853 Y93* probably null Het
Erich6b T A 14: 75,658,900 D75E possibly damaging Het
Exoc3l4 T A 12: 111,424,042 Y350* probably null Het
Fam13a T A 6: 58,956,699 D302V probably damaging Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Fga C T 3: 83,033,133 T698I possibly damaging Het
Fsip2 T C 2: 83,008,848 S6987P possibly damaging Het
Gatsl3 T C 11: 4,218,378 L22P probably damaging Het
Gbp9 T A 5: 105,094,555 N106I possibly damaging Het
Gls T A 1: 52,196,752 K401N probably damaging Het
Gpatch2l A G 12: 86,244,480 K146E probably damaging Het
Gpr3 A G 4: 133,210,408 S318P probably benign Het
Kbtbd7 T C 14: 79,428,765 V679A possibly damaging Het
Kcnu1 T A 8: 25,919,650 L127H probably damaging Het
Lck G T 4: 129,556,310 H214Q probably benign Het
Lrch4 A C 5: 137,637,926 S380R possibly damaging Het
Lrrk2 A T 15: 91,702,222 K414* probably null Het
Med11 A G 11: 70,453,232 E126G probably damaging Het
Mknk1 A G 4: 115,855,006 probably null Het
Mst1 T C 9: 108,082,908 C355R probably damaging Het
Nfrkb C T 9: 31,414,636 T1125M probably benign Het
Nin T C 12: 70,042,769 T1291A probably damaging Het
Pcnt T C 10: 76,429,271 Q335R probably damaging Het
Phc2 A G 4: 128,745,095 T83A probably damaging Het
Rdh19 T A 10: 127,856,887 M141K probably benign Het
Rnf17 G A 14: 56,471,399 V759I probably benign Het
Sirt7 A T 11: 120,620,851 Y18* probably null Het
Slc27a5 T C 7: 12,998,083 probably benign Het
Soga1 T A 2: 157,030,921 E890V probably damaging Het
Synpo2 T A 3: 123,121,210 I56F probably damaging Het
Tdrd6 C A 17: 43,626,408 G1250C probably damaging Het
Tmem190 G A 7: 4,784,289 G164D probably damaging Het
Tmem57 A T 4: 134,828,058 M368K probably benign Het
Tmigd1 T C 11: 76,907,032 Y67H probably damaging Het
Trim3 T A 7: 105,619,536 E70D probably damaging Het
Uap1 A G 1: 170,166,845 F21L possibly damaging Het
Vmn1r176 A T 7: 23,835,500 V76D probably benign Het
Vps13d A C 4: 145,087,173 S3245A probably benign Het
Wnt7a T C 6: 91,366,204 Y232C probably damaging Het
Zan A G 5: 137,400,098 V4224A unknown Het
Other mutations in Myl10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03206:Myl10 APN 5 136697942 nonsense probably null
PIT4243001:Myl10 UTSW 5 136694293 missense probably benign 0.05
R4066:Myl10 UTSW 5 136695450 missense probably damaging 1.00
R6321:Myl10 UTSW 5 136697971 missense probably benign 0.00
R6322:Myl10 UTSW 5 136697971 missense probably benign 0.00
R6566:Myl10 UTSW 5 136697971 missense probably benign 0.00
R6756:Myl10 UTSW 5 136697971 missense probably benign 0.00
R6757:Myl10 UTSW 5 136697971 missense probably benign 0.00
R6894:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7033:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7152:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7242:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7411:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7484:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7535:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7537:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7630:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7631:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7635:Myl10 UTSW 5 136700864 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAGGTTCAGAGAGGGTTCC -3'
(R):5'- ACCAAGTCCTCTTGTCACATTG -3'

Sequencing Primer
(F):5'- TTCAGAGAGGGTTCCCAGGATG -3'
(R):5'- CAAGTCCTCTTGTCACATTGGAAAC -3'
Posted On2017-01-03