Incidental Mutation 'R5712:Lrch4'
ID450941
Institutional Source Beutler Lab
Gene Symbol Lrch4
Ensembl Gene ENSMUSG00000093445
Gene Nameleucine-rich repeats and calponin homology (CH) domain containing 4
Synonyms2810008P14Rik, LRN, LRRN4, 2900069C24Rik, SAP25
MMRRC Submission 043334-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R5712 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location137629121-137641099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 137637926 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 380 (S380R)
Ref Sequence ENSEMBL: ENSMUSP00000135286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031734] [ENSMUST00000166099] [ENSMUST00000175968] [ENSMUST00000176011] [ENSMUST00000176667] [ENSMUST00000177466] [ENSMUST00000177477] [ENSMUST00000177545]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031734
AA Change: S380R

PolyPhen 2 Score 0.571 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031734
Gene: ENSMUSG00000093445
AA Change: S380R

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
LRR 90 112 4.84e1 SMART
LRR_TYP 113 136 4.61e-5 SMART
LRR 158 180 2.63e0 SMART
LRR_TYP 181 204 1.1e-2 SMART
LRR 226 249 3.98e1 SMART
low complexity region 389 405 N/A INTRINSIC
low complexity region 440 453 N/A INTRINSIC
low complexity region 474 479 N/A INTRINSIC
low complexity region 510 530 N/A INTRINSIC
CH 533 642 9.24e-15 SMART
transmembrane domain 656 678 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166099
SMART Domains Protein: ENSMUSP00000127076
Gene: ENSMUSG00000079165

DomainStartEndE-ValueType
Pfam:SAP25 76 261 1.8e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175968
AA Change: S326R

PolyPhen 2 Score 0.400 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000134767
Gene: ENSMUSG00000093445
AA Change: S326R

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
LRR 36 58 4.84e1 SMART
LRR_TYP 59 82 4.61e-5 SMART
LRR 104 126 2.63e0 SMART
LRR_TYP 127 150 1.1e-2 SMART
LRR 172 195 3.98e1 SMART
low complexity region 335 351 N/A INTRINSIC
low complexity region 386 399 N/A INTRINSIC
low complexity region 420 425 N/A INTRINSIC
low complexity region 456 476 N/A INTRINSIC
CH 479 588 9.24e-15 SMART
transmembrane domain 602 624 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176011
SMART Domains Protein: ENSMUSP00000135133
Gene: ENSMUSG00000093445

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176256
Predicted Effect possibly damaging
Transcript: ENSMUST00000176667
AA Change: S380R

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000135832
Gene: ENSMUSG00000093445
AA Change: S380R

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
LRR 90 112 4.84e1 SMART
LRR_TYP 113 136 4.61e-5 SMART
LRR 158 180 2.63e0 SMART
LRR_TYP 181 204 1.1e-2 SMART
LRR 226 249 3.98e1 SMART
low complexity region 389 405 N/A INTRINSIC
low complexity region 440 453 N/A INTRINSIC
low complexity region 474 479 N/A INTRINSIC
low complexity region 510 530 N/A INTRINSIC
CH 533 648 4.73e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176768
Predicted Effect probably benign
Transcript: ENSMUST00000176871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177354
Predicted Effect probably benign
Transcript: ENSMUST00000177466
Predicted Effect probably benign
Transcript: ENSMUST00000177477
SMART Domains Protein: ENSMUSP00000135724
Gene: ENSMUSG00000093445

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000177545
AA Change: S380R

PolyPhen 2 Score 0.571 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000135286
Gene: ENSMUSG00000029720
AA Change: S380R

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
LRR 90 112 4.84e1 SMART
LRR_TYP 113 136 4.61e-5 SMART
LRR 158 180 2.63e0 SMART
LRR_TYP 181 204 1.1e-2 SMART
LRR 226 249 3.98e1 SMART
low complexity region 389 405 N/A INTRINSIC
low complexity region 440 453 N/A INTRINSIC
low complexity region 474 479 N/A INTRINSIC
low complexity region 510 530 N/A INTRINSIC
CH 533 642 9.24e-15 SMART
transmembrane domain 656 678 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains leucine-rich repeats (LRR) at its amino terminus and that is known to be involved in ligand binding. The carboxyl terminus may act as a membrane anchor. Identified structural elements suggest that the encoded protein resembles a receptor. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 145,044,753 T133A probably benign Het
Adcy8 C T 15: 64,754,866 E708K probably damaging Het
Alkbh1 A G 12: 87,429,113 C300R probably benign Het
Arhgap11a T C 2: 113,845,301 N52D probably benign Het
Ash1l T A 3: 89,051,990 S2225T probably damaging Het
Aspn A T 13: 49,563,519 Y257F probably damaging Het
Atp2b4 A C 1: 133,730,540 V544G probably damaging Het
Bclaf1 T G 10: 20,333,531 Y498D probably damaging Het
Cacna1d A G 14: 30,074,997 I1520T probably damaging Het
Cfap57 G T 4: 118,614,795 P129Q probably damaging Het
Clcn3 A G 8: 60,937,298 probably null Het
Epx A T 11: 87,874,853 Y93* probably null Het
Erich6b T A 14: 75,658,900 D75E possibly damaging Het
Exoc3l4 T A 12: 111,424,042 Y350* probably null Het
Fam13a T A 6: 58,956,699 D302V probably damaging Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Fga C T 3: 83,033,133 T698I possibly damaging Het
Fsip2 T C 2: 83,008,848 S6987P possibly damaging Het
Gatsl3 T C 11: 4,218,378 L22P probably damaging Het
Gbp9 T A 5: 105,094,555 N106I possibly damaging Het
Gls T A 1: 52,196,752 K401N probably damaging Het
Gpatch2l A G 12: 86,244,480 K146E probably damaging Het
Gpr3 A G 4: 133,210,408 S318P probably benign Het
Kbtbd7 T C 14: 79,428,765 V679A possibly damaging Het
Kcnu1 T A 8: 25,919,650 L127H probably damaging Het
Lck G T 4: 129,556,310 H214Q probably benign Het
Lrrk2 A T 15: 91,702,222 K414* probably null Het
Med11 A G 11: 70,453,232 E126G probably damaging Het
Mknk1 A G 4: 115,855,006 probably null Het
Mst1 T C 9: 108,082,908 C355R probably damaging Het
Myl10 T C 5: 136,694,238 F14L probably damaging Het
Nfrkb C T 9: 31,414,636 T1125M probably benign Het
Nin T C 12: 70,042,769 T1291A probably damaging Het
Pcnt T C 10: 76,429,271 Q335R probably damaging Het
Phc2 A G 4: 128,745,095 T83A probably damaging Het
Rdh19 T A 10: 127,856,887 M141K probably benign Het
Rnf17 G A 14: 56,471,399 V759I probably benign Het
Sirt7 A T 11: 120,620,851 Y18* probably null Het
Slc27a5 T C 7: 12,998,083 probably benign Het
Soga1 T A 2: 157,030,921 E890V probably damaging Het
Synpo2 T A 3: 123,121,210 I56F probably damaging Het
Tdrd6 C A 17: 43,626,408 G1250C probably damaging Het
Tmem190 G A 7: 4,784,289 G164D probably damaging Het
Tmem57 A T 4: 134,828,058 M368K probably benign Het
Tmigd1 T C 11: 76,907,032 Y67H probably damaging Het
Trim3 T A 7: 105,619,536 E70D probably damaging Het
Uap1 A G 1: 170,166,845 F21L possibly damaging Het
Vmn1r176 A T 7: 23,835,500 V76D probably benign Het
Vps13d A C 4: 145,087,173 S3245A probably benign Het
Wnt7a T C 6: 91,366,204 Y232C probably damaging Het
Zan A G 5: 137,400,098 V4224A unknown Het
Other mutations in Lrch4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Lrch4 APN 5 137637747 missense possibly damaging 0.49
IGL01862:Lrch4 APN 5 137637009 missense probably damaging 1.00
IGL03289:Lrch4 APN 5 137633577 missense probably damaging 1.00
R0144:Lrch4 UTSW 5 137638543 critical splice donor site probably null
R0724:Lrch4 UTSW 5 137637308 missense probably damaging 1.00
R1330:Lrch4 UTSW 5 137637789 missense probably damaging 0.99
R1557:Lrch4 UTSW 5 137637556 missense probably benign 0.00
R1694:Lrch4 UTSW 5 137638461 missense probably benign 0.00
R2358:Lrch4 UTSW 5 137638548 unclassified probably benign
R3755:Lrch4 UTSW 5 137637730 missense probably damaging 1.00
R3756:Lrch4 UTSW 5 137637730 missense probably damaging 1.00
R4608:Lrch4 UTSW 5 137639146 nonsense probably null
R5056:Lrch4 UTSW 5 137636851 missense probably damaging 1.00
R5114:Lrch4 UTSW 5 137637917 missense probably benign
R5181:Lrch4 UTSW 5 137629403 missense probably damaging 1.00
R5325:Lrch4 UTSW 5 137637906 missense probably damaging 1.00
R5430:Lrch4 UTSW 5 137638533 missense possibly damaging 0.46
R5846:Lrch4 UTSW 5 137633657 missense probably damaging 1.00
R5909:Lrch4 UTSW 5 137633865 missense possibly damaging 0.87
R7319:Lrch4 UTSW 5 137639715 missense
R7525:Lrch4 UTSW 5 137639465 missense probably damaging 1.00
R7761:Lrch4 UTSW 5 137639763 missense
RF009:Lrch4 UTSW 5 137637543 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GTGAGTATGGGCTGGAAACC -3'
(R):5'- CAACTGCAAAGTGTCTGGGC -3'

Sequencing Primer
(F):5'- GGAGCAGATTGACTTTATTGACAGCC -3'
(R):5'- ACCTTTGTCAGGTGAAGG -3'
Posted On2017-01-03