Incidental Mutation 'R5712:Mst1'
ID450954
Institutional Source Beutler Lab
Gene Symbol Mst1
Ensembl Gene ENSMUSG00000032591
Gene Namemacrophage stimulating 1 (hepatocyte growth factor-like)
SynonymsD9H3F15S2, DNF15S2h, D3F15S2h, Hgfl
MMRRC Submission 043334-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5712 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location108080436-108085003 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108082908 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 355 (C355R)
Ref Sequence ENSEMBL: ENSMUSP00000125175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035211] [ENSMUST00000047746] [ENSMUST00000159372] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000161828] [ENSMUST00000162355] [ENSMUST00000162516] [ENSMUST00000162886] [ENSMUST00000174504] [ENSMUST00000178267] [ENSMUST00000193254]
Predicted Effect probably damaging
Transcript: ENSMUST00000035211
AA Change: C364R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035211
Gene: ENSMUSG00000032591
AA Change: C364R

DomainStartEndE-ValueType
PAN_AP 21 104 2.65e-9 SMART
KR 108 188 3.13e-39 SMART
KR 189 270 8.57e-46 SMART
KR 290 372 7.94e-41 SMART
KR 377 459 6.59e-47 SMART
Tryp_SPc 488 709 2.27e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047746
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081309
SMART Domains Protein: ENSMUSP00000080058
Gene: ENSMUSG00000032590

DomainStartEndE-ValueType
Pfam:DLH 485 721 2e-8 PFAM
Pfam:Abhydrolase_1 501 633 3.8e-9 PFAM
Pfam:Abhydrolase_5 501 708 5e-16 PFAM
Pfam:Peptidase_S9 516 732 1.6e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159136
Predicted Effect probably benign
Transcript: ENSMUST00000159372
Predicted Effect probably benign
Transcript: ENSMUST00000160184
Predicted Effect probably benign
Transcript: ENSMUST00000160249
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160649
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161673
Predicted Effect probably benign
Transcript: ENSMUST00000161828
Predicted Effect probably benign
Transcript: ENSMUST00000162355
SMART Domains Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162516
Predicted Effect probably damaging
Transcript: ENSMUST00000162886
AA Change: C355R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125175
Gene: ENSMUSG00000032591
AA Change: C355R

DomainStartEndE-ValueType
PAN_AP 21 104 2.65e-9 SMART
KR 108 188 3.13e-39 SMART
KR 189 270 1.07e-46 SMART
KR 281 363 7.94e-41 SMART
KR 368 450 6.59e-47 SMART
Tryp_SPc 479 700 2.27e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174504
Predicted Effect probably benign
Transcript: ENSMUST00000178267
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192916
Predicted Effect probably benign
Transcript: ENSMUST00000193254
SMART Domains Protein: ENSMUSP00000141856
Gene: ENSMUSG00000032590

DomainStartEndE-ValueType
Pfam:DLH 485 721 4.8e-8 PFAM
Pfam:Abhydrolase_5 501 708 5.7e-16 PFAM
Pfam:Abhydrolase_6 503 714 6.2e-14 PFAM
Pfam:Peptidase_S9 515 732 1.4e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194915
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains four kringle domains and a serine protease domain, similar to that found in hepatic growth factor. Despite the presence of the serine protease domain, the encoded protein may not have any proteolytic activity. The receptor for this protein is RON tyrosine kinase, which upon activation stimulates ciliary motility of ciliated epithelial lung cells. This protein is secreted and cleaved to form an alpha chain and a beta chain bridged by disulfide bonds. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lipid-filled cytoplasmic vacuoles in hepatocytes throughout the liver lobules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 145,044,753 T133A probably benign Het
Adcy8 C T 15: 64,754,866 E708K probably damaging Het
Alkbh1 A G 12: 87,429,113 C300R probably benign Het
Arhgap11a T C 2: 113,845,301 N52D probably benign Het
Ash1l T A 3: 89,051,990 S2225T probably damaging Het
Aspn A T 13: 49,563,519 Y257F probably damaging Het
Atp2b4 A C 1: 133,730,540 V544G probably damaging Het
Bclaf1 T G 10: 20,333,531 Y498D probably damaging Het
Cacna1d A G 14: 30,074,997 I1520T probably damaging Het
Cfap57 G T 4: 118,614,795 P129Q probably damaging Het
Clcn3 A G 8: 60,937,298 probably null Het
Epx A T 11: 87,874,853 Y93* probably null Het
Erich6b T A 14: 75,658,900 D75E possibly damaging Het
Exoc3l4 T A 12: 111,424,042 Y350* probably null Het
Fam13a T A 6: 58,956,699 D302V probably damaging Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Fga C T 3: 83,033,133 T698I possibly damaging Het
Fsip2 T C 2: 83,008,848 S6987P possibly damaging Het
Gatsl3 T C 11: 4,218,378 L22P probably damaging Het
Gbp9 T A 5: 105,094,555 N106I possibly damaging Het
Gls T A 1: 52,196,752 K401N probably damaging Het
Gpatch2l A G 12: 86,244,480 K146E probably damaging Het
Gpr3 A G 4: 133,210,408 S318P probably benign Het
Kbtbd7 T C 14: 79,428,765 V679A possibly damaging Het
Kcnu1 T A 8: 25,919,650 L127H probably damaging Het
Lck G T 4: 129,556,310 H214Q probably benign Het
Lrch4 A C 5: 137,637,926 S380R possibly damaging Het
Lrrk2 A T 15: 91,702,222 K414* probably null Het
Med11 A G 11: 70,453,232 E126G probably damaging Het
Mknk1 A G 4: 115,855,006 probably null Het
Myl10 T C 5: 136,694,238 F14L probably damaging Het
Nfrkb C T 9: 31,414,636 T1125M probably benign Het
Nin T C 12: 70,042,769 T1291A probably damaging Het
Pcnt T C 10: 76,429,271 Q335R probably damaging Het
Phc2 A G 4: 128,745,095 T83A probably damaging Het
Rdh19 T A 10: 127,856,887 M141K probably benign Het
Rnf17 G A 14: 56,471,399 V759I probably benign Het
Sirt7 A T 11: 120,620,851 Y18* probably null Het
Slc27a5 T C 7: 12,998,083 probably benign Het
Soga1 T A 2: 157,030,921 E890V probably damaging Het
Synpo2 T A 3: 123,121,210 I56F probably damaging Het
Tdrd6 C A 17: 43,626,408 G1250C probably damaging Het
Tmem190 G A 7: 4,784,289 G164D probably damaging Het
Tmem57 A T 4: 134,828,058 M368K probably benign Het
Tmigd1 T C 11: 76,907,032 Y67H probably damaging Het
Trim3 T A 7: 105,619,536 E70D probably damaging Het
Uap1 A G 1: 170,166,845 F21L possibly damaging Het
Vmn1r176 A T 7: 23,835,500 V76D probably benign Het
Vps13d A C 4: 145,087,173 S3245A probably benign Het
Wnt7a T C 6: 91,366,204 Y232C probably damaging Het
Zan A G 5: 137,400,098 V4224A unknown Het
Other mutations in Mst1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Mst1 APN 9 108081601 missense probably benign 0.03
IGL01380:Mst1 APN 9 108084588 missense probably damaging 1.00
IGL01420:Mst1 APN 9 108082828 missense probably damaging 0.99
IGL02931:Mst1 APN 9 108084642 intron probably null
IGL03059:Mst1 APN 9 108084813 missense probably damaging 1.00
IGL03275:Mst1 APN 9 108084388 missense possibly damaging 0.70
R0319:Mst1 UTSW 9 108082513 missense probably benign 0.05
R0361:Mst1 UTSW 9 108084897 missense probably damaging 0.98
R0412:Mst1 UTSW 9 108083594 missense probably benign 0.06
R0569:Mst1 UTSW 9 108082301 missense probably damaging 0.98
R1432:Mst1 UTSW 9 108084204 missense probably benign 0.01
R1483:Mst1 UTSW 9 108081650 missense probably benign 0.03
R1859:Mst1 UTSW 9 108084346 missense probably benign 0.23
R2187:Mst1 UTSW 9 108084340 missense possibly damaging 0.63
R2393:Mst1 UTSW 9 108082952 critical splice donor site probably null
R3522:Mst1 UTSW 9 108081503 unclassified probably benign
R3916:Mst1 UTSW 9 108084295 missense probably benign 0.00
R3917:Mst1 UTSW 9 108084295 missense probably benign 0.00
R3945:Mst1 UTSW 9 108084853 missense probably damaging 1.00
R4006:Mst1 UTSW 9 108082948 missense possibly damaging 0.52
R4007:Mst1 UTSW 9 108082948 missense possibly damaging 0.52
R4737:Mst1 UTSW 9 108080521 missense probably benign 0.00
R4756:Mst1 UTSW 9 108083627 missense probably benign 0.28
R5047:Mst1 UTSW 9 108084309 missense probably benign 0.17
R5113:Mst1 UTSW 9 108082247 missense probably damaging 1.00
R5278:Mst1 UTSW 9 108082215 missense probably damaging 0.99
R5279:Mst1 UTSW 9 108082215 missense probably damaging 0.99
R5402:Mst1 UTSW 9 108084209 critical splice donor site probably null
R5677:Mst1 UTSW 9 108081286 missense probably damaging 0.98
R6717:Mst1 UTSW 9 108080575 intron probably null
R7059:Mst1 UTSW 9 108084064 missense probably benign 0.44
R7131:Mst1 UTSW 9 108084931 missense probably null 0.07
R7139:Mst1 UTSW 9 108082828 missense probably damaging 0.99
R7219:Mst1 UTSW 9 108081286 missense probably damaging 0.99
R7501:Mst1 UTSW 9 108082549 missense probably damaging 1.00
X0028:Mst1 UTSW 9 108082217 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCTTGCAAGTGAGGTGAC -3'
(R):5'- AAGGCCCTATCTGCACATAGC -3'

Sequencing Primer
(F):5'- CAGGGAGAGTGCACCTGTG -3'
(R):5'- TGTCTCAGAGGACCAGTGCTG -3'
Posted On2017-01-03