Incidental Mutation 'R5712:Exoc3l4'
ID450968
Institutional Source Beutler Lab
Gene Symbol Exoc3l4
Ensembl Gene ENSMUSG00000021280
Gene Nameexocyst complex component 3-like 4
Synonyms
MMRRC Submission 043334-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R5712 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location111417017-111431678 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 111424042 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 350 (Y350*)
Ref Sequence ENSEMBL: ENSMUSP00000152337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072646] [ENSMUST00000220537] [ENSMUST00000220852] [ENSMUST00000221144] [ENSMUST00000222437] [ENSMUST00000222897] [ENSMUST00000223050] [ENSMUST00000223431]
Predicted Effect probably null
Transcript: ENSMUST00000072646
AA Change: Y350*
SMART Domains Protein: ENSMUSP00000072438
Gene: ENSMUSG00000021280
AA Change: Y350*

DomainStartEndE-ValueType
low complexity region 75 89 N/A INTRINSIC
Pfam:Sec6 181 708 7.1e-111 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181085
Predicted Effect probably benign
Transcript: ENSMUST00000220537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220636
Predicted Effect probably benign
Transcript: ENSMUST00000220852
Predicted Effect probably benign
Transcript: ENSMUST00000221144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222262
Predicted Effect probably benign
Transcript: ENSMUST00000222437
Predicted Effect probably null
Transcript: ENSMUST00000222897
AA Change: Y350*
Predicted Effect probably null
Transcript: ENSMUST00000223050
AA Change: Y350*
Predicted Effect probably benign
Transcript: ENSMUST00000223431
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 145,044,753 T133A probably benign Het
Adcy8 C T 15: 64,754,866 E708K probably damaging Het
Alkbh1 A G 12: 87,429,113 C300R probably benign Het
Arhgap11a T C 2: 113,845,301 N52D probably benign Het
Ash1l T A 3: 89,051,990 S2225T probably damaging Het
Aspn A T 13: 49,563,519 Y257F probably damaging Het
Atp2b4 A C 1: 133,730,540 V544G probably damaging Het
Bclaf1 T G 10: 20,333,531 Y498D probably damaging Het
Cacna1d A G 14: 30,074,997 I1520T probably damaging Het
Cfap57 G T 4: 118,614,795 P129Q probably damaging Het
Clcn3 A G 8: 60,937,298 probably null Het
Epx A T 11: 87,874,853 Y93* probably null Het
Erich6b T A 14: 75,658,900 D75E possibly damaging Het
Fam13a T A 6: 58,956,699 D302V probably damaging Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Fga C T 3: 83,033,133 T698I possibly damaging Het
Fsip2 T C 2: 83,008,848 S6987P possibly damaging Het
Gatsl3 T C 11: 4,218,378 L22P probably damaging Het
Gbp9 T A 5: 105,094,555 N106I possibly damaging Het
Gls T A 1: 52,196,752 K401N probably damaging Het
Gpatch2l A G 12: 86,244,480 K146E probably damaging Het
Gpr3 A G 4: 133,210,408 S318P probably benign Het
Kbtbd7 T C 14: 79,428,765 V679A possibly damaging Het
Kcnu1 T A 8: 25,919,650 L127H probably damaging Het
Lck G T 4: 129,556,310 H214Q probably benign Het
Lrch4 A C 5: 137,637,926 S380R possibly damaging Het
Lrrk2 A T 15: 91,702,222 K414* probably null Het
Med11 A G 11: 70,453,232 E126G probably damaging Het
Mknk1 A G 4: 115,855,006 probably null Het
Mst1 T C 9: 108,082,908 C355R probably damaging Het
Myl10 T C 5: 136,694,238 F14L probably damaging Het
Nfrkb C T 9: 31,414,636 T1125M probably benign Het
Nin T C 12: 70,042,769 T1291A probably damaging Het
Pcnt T C 10: 76,429,271 Q335R probably damaging Het
Phc2 A G 4: 128,745,095 T83A probably damaging Het
Rdh19 T A 10: 127,856,887 M141K probably benign Het
Rnf17 G A 14: 56,471,399 V759I probably benign Het
Sirt7 A T 11: 120,620,851 Y18* probably null Het
Slc27a5 T C 7: 12,998,083 probably benign Het
Soga1 T A 2: 157,030,921 E890V probably damaging Het
Synpo2 T A 3: 123,121,210 I56F probably damaging Het
Tdrd6 C A 17: 43,626,408 G1250C probably damaging Het
Tmem190 G A 7: 4,784,289 G164D probably damaging Het
Tmem57 A T 4: 134,828,058 M368K probably benign Het
Tmigd1 T C 11: 76,907,032 Y67H probably damaging Het
Trim3 T A 7: 105,619,536 E70D probably damaging Het
Uap1 A G 1: 170,166,845 F21L possibly damaging Het
Vmn1r176 A T 7: 23,835,500 V76D probably benign Het
Vps13d A C 4: 145,087,173 S3245A probably benign Het
Wnt7a T C 6: 91,366,204 Y232C probably damaging Het
Zan A G 5: 137,400,098 V4224A unknown Het
Other mutations in Exoc3l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01663:Exoc3l4 APN 12 111429411 splice site probably benign
IGL02048:Exoc3l4 APN 12 111428483 missense probably benign 0.00
IGL03049:Exoc3l4 APN 12 111423401 missense probably damaging 0.96
IGL03069:Exoc3l4 APN 12 111424023 missense probably damaging 1.00
IGL03123:Exoc3l4 APN 12 111422113 missense probably damaging 1.00
R0631:Exoc3l4 UTSW 12 111427966 missense probably benign 0.34
R1377:Exoc3l4 UTSW 12 111428670 missense probably damaging 1.00
R2223:Exoc3l4 UTSW 12 111426152 missense possibly damaging 0.73
R2402:Exoc3l4 UTSW 12 111422256 missense possibly damaging 0.94
R2884:Exoc3l4 UTSW 12 111428522 missense possibly damaging 0.93
R3770:Exoc3l4 UTSW 12 111425555 missense probably benign
R4843:Exoc3l4 UTSW 12 111428053 intron probably benign
R4903:Exoc3l4 UTSW 12 111428721 missense probably benign 0.00
R4964:Exoc3l4 UTSW 12 111428721 missense probably benign 0.00
R4966:Exoc3l4 UTSW 12 111428721 missense probably benign 0.00
R5082:Exoc3l4 UTSW 12 111427990 missense probably benign 0.04
R5152:Exoc3l4 UTSW 12 111430893 utr 3 prime probably benign
R5210:Exoc3l4 UTSW 12 111428841 intron probably benign
R5667:Exoc3l4 UTSW 12 111423417 missense probably damaging 1.00
R5671:Exoc3l4 UTSW 12 111423417 missense probably damaging 1.00
R5873:Exoc3l4 UTSW 12 111423416 missense probably damaging 1.00
R5947:Exoc3l4 UTSW 12 111422401 missense possibly damaging 0.94
R6299:Exoc3l4 UTSW 12 111422079 start codon destroyed possibly damaging 0.59
R6332:Exoc3l4 UTSW 12 111427968 missense possibly damaging 0.79
R6489:Exoc3l4 UTSW 12 111428697 missense probably damaging 1.00
R7225:Exoc3l4 UTSW 12 111423624 missense probably benign 0.10
R7643:Exoc3l4 UTSW 12 111421935 intron probably benign
R7731:Exoc3l4 UTSW 12 111430748 missense possibly damaging 0.94
R7791:Exoc3l4 UTSW 12 111423540 missense probably damaging 1.00
Z1088:Exoc3l4 UTSW 12 111429487 missense probably benign 0.29
Z1176:Exoc3l4 UTSW 12 111423720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAAGGTGCGCTTAGAGATGC -3'
(R):5'- TAGCTTTGGGAATCTGCGC -3'

Sequencing Primer
(F):5'- TTAGAGATGCAGCCCGCTTAC -3'
(R):5'- TCCCTTAGGAAAACCTGGGATG -3'
Posted On2017-01-03