Incidental Mutation 'R5712:Cacna1d'
ID 450970
Institutional Source Beutler Lab
Gene Symbol Cacna1d
Ensembl Gene ENSMUSG00000015968
Gene Name calcium channel, voltage-dependent, L type, alpha 1D subunit
Synonyms Cacnl1a2, Cchl1a2, C79217, Cchl1a, Cav1.3alpha1, 8430418G19Rik, D-LTCC
MMRRC Submission 043334-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.900) question?
Stock # R5712 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 29761898-30213113 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 29796954 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 1520 (I1520T)
Ref Sequence ENSEMBL: ENSMUSP00000153250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112249] [ENSMUST00000112250] [ENSMUST00000223803] [ENSMUST00000224198] [ENSMUST00000224395] [ENSMUST00000224785]
AlphaFold Q99246
Predicted Effect probably damaging
Transcript: ENSMUST00000112249
AA Change: I1485T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107868
Gene: ENSMUSG00000015968
AA Change: I1485T

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
Pfam:Ion_trans 163 405 4.8e-59 PFAM
PDB:4DEY|B 406 502 3e-38 PDB
low complexity region 503 517 N/A INTRINSIC
Pfam:Ion_trans 557 751 5.5e-46 PFAM
low complexity region 766 781 N/A INTRINSIC
low complexity region 819 840 N/A INTRINSIC
Pfam:Ion_trans 921 1151 7.2e-51 PFAM
Pfam:Ion_trans 1239 1448 3.6e-67 PFAM
Pfam:PKD_channel 1285 1455 1.9e-9 PFAM
Blast:EFh 1469 1497 2e-9 BLAST
Ca_chan_IQ 1583 1617 5.05e-16 SMART
low complexity region 1649 1661 N/A INTRINSIC
low complexity region 1722 1728 N/A INTRINSIC
low complexity region 1830 1840 N/A INTRINSIC
low complexity region 1885 1905 N/A INTRINSIC
low complexity region 1921 1936 N/A INTRINSIC
low complexity region 2122 2133 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112250
AA Change: I1507T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107869
Gene: ENSMUSG00000015968
AA Change: I1507T

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
Pfam:Ion_trans 147 439 5.6e-72 PFAM
low complexity region 473 482 N/A INTRINSIC
low complexity region 525 539 N/A INTRINSIC
Pfam:Ion_trans 544 784 2e-56 PFAM
low complexity region 788 803 N/A INTRINSIC
low complexity region 841 862 N/A INTRINSIC
Pfam:Ion_trans 907 1185 2.6e-63 PFAM
Pfam:Ion_trans 1226 1482 1.7e-70 PFAM
Pfam:PKD_channel 1306 1477 1.2e-9 PFAM
Pfam:GPHH 1484 1553 2.3e-38 PFAM
Ca_chan_IQ 1605 1639 5.05e-16 SMART
Pfam:CAC1F_C 1649 2165 1.1e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000223803
AA Change: I1485T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224198
AA Change: I1520T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000224395
Predicted Effect probably damaging
Transcript: ENSMUST00000224785
AA Change: I1485T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000224912
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225717
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a pore-forming subunit of the L-type, voltage-activated calcium channel family. These channels have been found to play a role in heart and smooth muscle contraction and in the transmission of auditory information. Homozygous knockout mice for this gene exhibit deafness and heart defects. These channels have also been linked to mitochondrial oxidative stress in a mouse model of Parkinson's disease. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes for targeted mutations exhibit small size, hypoinsulinemia, glucose intolerance, decreased number and size of pancreatic islets, deafness with degeneration of hair cells, bradycardia, and arrhythmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 144,981,563 (GRCm39) T133A probably benign Het
Adcy8 C T 15: 64,626,715 (GRCm39) E708K probably damaging Het
Alkbh1 A G 12: 87,475,883 (GRCm39) C300R probably benign Het
Arhgap11a T C 2: 113,675,646 (GRCm39) N52D probably benign Het
Ash1l T A 3: 88,959,297 (GRCm39) S2225T probably damaging Het
Aspn A T 13: 49,716,995 (GRCm39) Y257F probably damaging Het
Atp2b4 A C 1: 133,658,278 (GRCm39) V544G probably damaging Het
Bclaf1 T G 10: 20,209,277 (GRCm39) Y498D probably damaging Het
Castor1 T C 11: 4,168,378 (GRCm39) L22P probably damaging Het
Cfap57 G T 4: 118,471,992 (GRCm39) P129Q probably damaging Het
Clcn3 A G 8: 61,390,332 (GRCm39) probably null Het
Epx A T 11: 87,765,679 (GRCm39) Y93* probably null Het
Erich6b T A 14: 75,896,340 (GRCm39) D75E possibly damaging Het
Exoc3l4 T A 12: 111,390,476 (GRCm39) Y350* probably null Het
Fam13a T A 6: 58,933,684 (GRCm39) D302V probably damaging Het
Fbxo17 G A 7: 28,436,897 (GRCm39) R284H probably damaging Het
Fga C T 3: 82,940,440 (GRCm39) T698I possibly damaging Het
Fsip2 T C 2: 82,839,192 (GRCm39) S6987P possibly damaging Het
Gbp9 T A 5: 105,242,421 (GRCm39) N106I possibly damaging Het
Gls T A 1: 52,235,911 (GRCm39) K401N probably damaging Het
Gpatch2l A G 12: 86,291,254 (GRCm39) K146E probably damaging Het
Gpr3 A G 4: 132,937,719 (GRCm39) S318P probably benign Het
Kbtbd7 T C 14: 79,666,205 (GRCm39) V679A possibly damaging Het
Kcnu1 T A 8: 26,409,678 (GRCm39) L127H probably damaging Het
Lck G T 4: 129,450,103 (GRCm39) H214Q probably benign Het
Lrch4 A C 5: 137,636,188 (GRCm39) S380R possibly damaging Het
Lrrk2 A T 15: 91,586,425 (GRCm39) K414* probably null Het
Maco1 A T 4: 134,555,369 (GRCm39) M368K probably benign Het
Med11 A G 11: 70,344,058 (GRCm39) E126G probably damaging Het
Mknk1 A G 4: 115,712,203 (GRCm39) probably null Het
Mst1 T C 9: 107,960,107 (GRCm39) C355R probably damaging Het
Mtcl2 T A 2: 156,872,841 (GRCm39) E890V probably damaging Het
Myl10 T C 5: 136,723,092 (GRCm39) F14L probably damaging Het
Nfrkb C T 9: 31,325,932 (GRCm39) T1125M probably benign Het
Nin T C 12: 70,089,543 (GRCm39) T1291A probably damaging Het
Pcnt T C 10: 76,265,105 (GRCm39) Q335R probably damaging Het
Phc2 A G 4: 128,638,888 (GRCm39) T83A probably damaging Het
Rdh19 T A 10: 127,692,756 (GRCm39) M141K probably benign Het
Rnf17 G A 14: 56,708,856 (GRCm39) V759I probably benign Het
Sirt7 A T 11: 120,511,677 (GRCm39) Y18* probably null Het
Slc27a5 T C 7: 12,732,010 (GRCm39) probably benign Het
Synpo2 T A 3: 122,914,859 (GRCm39) I56F probably damaging Het
Tdrd6 C A 17: 43,937,299 (GRCm39) G1250C probably damaging Het
Tmem190 G A 7: 4,787,288 (GRCm39) G164D probably damaging Het
Tmigd1 T C 11: 76,797,858 (GRCm39) Y67H probably damaging Het
Trim3 T A 7: 105,268,743 (GRCm39) E70D probably damaging Het
Uap1 A G 1: 169,994,414 (GRCm39) F21L possibly damaging Het
Vmn1r176 A T 7: 23,534,925 (GRCm39) V76D probably benign Het
Vps13d A C 4: 144,813,743 (GRCm39) S3245A probably benign Het
Wnt7a T C 6: 91,343,186 (GRCm39) Y232C probably damaging Het
Zan A G 5: 137,398,360 (GRCm39) V4224A unknown Het
Other mutations in Cacna1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Cacna1d APN 14 29,818,907 (GRCm39) missense probably damaging 0.97
IGL00857:Cacna1d APN 14 30,072,638 (GRCm39) missense possibly damaging 0.83
IGL01015:Cacna1d APN 14 29,773,699 (GRCm39) splice site probably benign
IGL01420:Cacna1d APN 14 29,773,595 (GRCm39) missense probably benign 0.01
IGL01470:Cacna1d APN 14 29,821,099 (GRCm39) missense probably damaging 0.99
IGL01560:Cacna1d APN 14 29,821,163 (GRCm39) missense probably benign 0.00
IGL01617:Cacna1d APN 14 29,824,328 (GRCm39) missense probably damaging 1.00
IGL01820:Cacna1d APN 14 29,764,823 (GRCm39) missense possibly damaging 0.79
IGL01948:Cacna1d APN 14 29,846,751 (GRCm39) missense probably damaging 1.00
IGL02702:Cacna1d APN 14 29,845,490 (GRCm39) nonsense probably null
IGL02864:Cacna1d APN 14 29,773,663 (GRCm39) missense probably benign 0.10
IGL03082:Cacna1d APN 14 29,821,190 (GRCm39) missense probably damaging 1.00
Brisk UTSW 14 29,893,271 (GRCm39) missense possibly damaging 0.91
Troppo UTSW 14 29,845,411 (GRCm39) missense probably damaging 1.00
PIT4651001:Cacna1d UTSW 14 29,900,602 (GRCm39) missense probably damaging 1.00
R0015:Cacna1d UTSW 14 29,836,928 (GRCm39) missense probably benign 0.00
R0015:Cacna1d UTSW 14 29,836,928 (GRCm39) missense probably benign 0.00
R0033:Cacna1d UTSW 14 29,827,446 (GRCm39) missense probably damaging 0.99
R0047:Cacna1d UTSW 14 30,068,747 (GRCm39) splice site probably benign
R0047:Cacna1d UTSW 14 30,068,747 (GRCm39) splice site probably benign
R0051:Cacna1d UTSW 14 29,833,052 (GRCm39) missense probably damaging 1.00
R0051:Cacna1d UTSW 14 29,833,052 (GRCm39) missense probably damaging 1.00
R0067:Cacna1d UTSW 14 29,796,967 (GRCm39) unclassified probably benign
R0067:Cacna1d UTSW 14 29,796,967 (GRCm39) unclassified probably benign
R0238:Cacna1d UTSW 14 29,845,453 (GRCm39) missense probably benign 0.29
R0238:Cacna1d UTSW 14 29,845,453 (GRCm39) missense probably benign 0.29
R0239:Cacna1d UTSW 14 29,845,453 (GRCm39) missense probably benign 0.29
R0239:Cacna1d UTSW 14 29,845,453 (GRCm39) missense probably benign 0.29
R0240:Cacna1d UTSW 14 29,818,926 (GRCm39) missense probably benign 0.00
R0240:Cacna1d UTSW 14 29,818,926 (GRCm39) missense probably benign 0.00
R0284:Cacna1d UTSW 14 29,794,062 (GRCm39) missense probably damaging 1.00
R0416:Cacna1d UTSW 14 29,822,645 (GRCm39) splice site probably benign
R0427:Cacna1d UTSW 14 30,068,774 (GRCm39) missense probably damaging 0.99
R0517:Cacna1d UTSW 14 29,901,232 (GRCm39) missense probably damaging 1.00
R0639:Cacna1d UTSW 14 29,893,251 (GRCm39) critical splice donor site probably null
R0727:Cacna1d UTSW 14 29,852,072 (GRCm39) critical splice donor site probably null
R0732:Cacna1d UTSW 14 29,764,877 (GRCm39) missense probably damaging 0.99
R0843:Cacna1d UTSW 14 29,846,828 (GRCm39) missense probably damaging 1.00
R0900:Cacna1d UTSW 14 29,833,039 (GRCm39) missense probably damaging 1.00
R1278:Cacna1d UTSW 14 29,900,660 (GRCm39) missense probably damaging 1.00
R1340:Cacna1d UTSW 14 29,794,024 (GRCm39) missense probably damaging 0.96
R1527:Cacna1d UTSW 14 29,829,753 (GRCm39) missense probably damaging 1.00
R1711:Cacna1d UTSW 14 29,788,013 (GRCm39) missense probably damaging 1.00
R1736:Cacna1d UTSW 14 29,811,820 (GRCm39) missense probably damaging 1.00
R1763:Cacna1d UTSW 14 29,821,153 (GRCm39) missense probably benign 0.25
R2034:Cacna1d UTSW 14 29,811,820 (GRCm39) missense probably damaging 1.00
R2086:Cacna1d UTSW 14 29,769,314 (GRCm39) missense possibly damaging 0.83
R2126:Cacna1d UTSW 14 29,845,120 (GRCm39) missense probably damaging 1.00
R2218:Cacna1d UTSW 14 29,845,048 (GRCm39) missense probably damaging 1.00
R2219:Cacna1d UTSW 14 29,764,047 (GRCm39) missense probably damaging 1.00
R2262:Cacna1d UTSW 14 30,212,973 (GRCm39) missense possibly damaging 0.46
R2291:Cacna1d UTSW 14 29,764,299 (GRCm39) missense probably damaging 1.00
R2399:Cacna1d UTSW 14 29,774,444 (GRCm39) missense probably benign 0.34
R2424:Cacna1d UTSW 14 29,770,980 (GRCm39) missense probably damaging 0.96
R2568:Cacna1d UTSW 14 29,804,468 (GRCm39) missense probably damaging 0.99
R4038:Cacna1d UTSW 14 29,788,040 (GRCm39) missense probably damaging 0.96
R4509:Cacna1d UTSW 14 29,818,928 (GRCm39) missense probably damaging 1.00
R4649:Cacna1d UTSW 14 29,817,365 (GRCm39) missense probably benign
R4650:Cacna1d UTSW 14 29,817,365 (GRCm39) missense probably benign
R4652:Cacna1d UTSW 14 29,817,365 (GRCm39) missense probably benign
R5009:Cacna1d UTSW 14 29,801,289 (GRCm39) missense probably damaging 1.00
R5058:Cacna1d UTSW 14 29,836,201 (GRCm39) nonsense probably null
R5063:Cacna1d UTSW 14 29,773,340 (GRCm39) missense probably benign
R5138:Cacna1d UTSW 14 30,212,929 (GRCm39) missense probably benign
R5151:Cacna1d UTSW 14 29,845,280 (GRCm39) missense probably damaging 1.00
R5278:Cacna1d UTSW 14 30,074,881 (GRCm39) critical splice donor site probably null
R5286:Cacna1d UTSW 14 30,072,682 (GRCm39) missense possibly damaging 0.69
R5313:Cacna1d UTSW 14 30,068,798 (GRCm39) missense probably benign 0.38
R5383:Cacna1d UTSW 14 29,767,236 (GRCm39) missense possibly damaging 0.51
R5387:Cacna1d UTSW 14 29,822,708 (GRCm39) missense probably damaging 1.00
R5514:Cacna1d UTSW 14 30,072,790 (GRCm39) nonsense probably null
R5524:Cacna1d UTSW 14 29,764,086 (GRCm39) missense probably benign 0.01
R5663:Cacna1d UTSW 14 29,845,297 (GRCm39) missense probably damaging 1.00
R5796:Cacna1d UTSW 14 29,788,073 (GRCm39) missense probably damaging 1.00
R5906:Cacna1d UTSW 14 29,818,917 (GRCm39) missense probably damaging 1.00
R5923:Cacna1d UTSW 14 29,833,105 (GRCm39) missense probably damaging 1.00
R5936:Cacna1d UTSW 14 29,893,271 (GRCm39) missense possibly damaging 0.91
R5938:Cacna1d UTSW 14 29,825,692 (GRCm39) missense probably damaging 1.00
R6041:Cacna1d UTSW 14 29,764,314 (GRCm39) missense probably damaging 1.00
R6432:Cacna1d UTSW 14 29,845,411 (GRCm39) missense probably damaging 1.00
R6486:Cacna1d UTSW 14 29,836,190 (GRCm39) missense probably benign 0.01
R6600:Cacna1d UTSW 14 29,836,192 (GRCm39) missense probably benign 0.15
R6661:Cacna1d UTSW 14 29,811,832 (GRCm39) missense probably damaging 1.00
R6753:Cacna1d UTSW 14 29,764,743 (GRCm39) missense probably damaging 1.00
R6804:Cacna1d UTSW 14 29,773,622 (GRCm39) missense probably benign 0.00
R6851:Cacna1d UTSW 14 29,764,739 (GRCm39) missense probably damaging 1.00
R6863:Cacna1d UTSW 14 29,797,809 (GRCm39) missense probably damaging 1.00
R6916:Cacna1d UTSW 14 29,817,321 (GRCm39) missense probably damaging 1.00
R6925:Cacna1d UTSW 14 29,773,594 (GRCm39) missense probably benign
R7066:Cacna1d UTSW 14 30,074,935 (GRCm39) intron probably benign
R7188:Cacna1d UTSW 14 29,811,790 (GRCm39) missense probably benign
R7242:Cacna1d UTSW 14 29,900,663 (GRCm39) missense probably benign 0.00
R7249:Cacna1d UTSW 14 29,864,660 (GRCm39) missense probably damaging 1.00
R7250:Cacna1d UTSW 14 29,797,108 (GRCm39) missense probably damaging 1.00
R7274:Cacna1d UTSW 14 29,864,600 (GRCm39) missense probably damaging 1.00
R7336:Cacna1d UTSW 14 29,767,239 (GRCm39) missense probably benign 0.18
R7343:Cacna1d UTSW 14 29,845,014 (GRCm39) missense probably benign 0.02
R7411:Cacna1d UTSW 14 30,074,947 (GRCm39) start codon destroyed probably null
R7461:Cacna1d UTSW 14 29,788,120 (GRCm39) missense probably benign 0.05
R7534:Cacna1d UTSW 14 29,801,319 (GRCm39) missense probably damaging 1.00
R7613:Cacna1d UTSW 14 29,788,120 (GRCm39) missense probably benign 0.05
R7661:Cacna1d UTSW 14 29,769,177 (GRCm39) missense probably benign 0.07
R7754:Cacna1d UTSW 14 29,797,809 (GRCm39) missense probably damaging 1.00
R7759:Cacna1d UTSW 14 29,821,145 (GRCm39) missense probably benign 0.01
R7784:Cacna1d UTSW 14 29,845,396 (GRCm39) missense probably damaging 1.00
R7808:Cacna1d UTSW 14 29,833,026 (GRCm39) missense probably damaging 1.00
R7965:Cacna1d UTSW 14 29,769,270 (GRCm39) nonsense probably null
R8225:Cacna1d UTSW 14 29,844,990 (GRCm39) missense probably benign 0.23
R8259:Cacna1d UTSW 14 29,773,475 (GRCm39) missense probably benign
R8348:Cacna1d UTSW 14 29,824,364 (GRCm39) missense probably damaging 1.00
R8448:Cacna1d UTSW 14 29,824,364 (GRCm39) missense probably damaging 1.00
R8822:Cacna1d UTSW 14 29,900,692 (GRCm39) missense probably benign 0.02
R8848:Cacna1d UTSW 14 29,845,283 (GRCm39) missense possibly damaging 0.89
R9122:Cacna1d UTSW 14 29,852,125 (GRCm39) missense probably benign 0.00
R9122:Cacna1d UTSW 14 29,845,402 (GRCm39) missense probably damaging 1.00
R9169:Cacna1d UTSW 14 29,796,873 (GRCm39) missense probably damaging 1.00
R9199:Cacna1d UTSW 14 29,764,893 (GRCm39) missense probably benign 0.26
R9203:Cacna1d UTSW 14 29,773,669 (GRCm39) missense probably benign 0.04
R9263:Cacna1d UTSW 14 29,796,925 (GRCm39) missense probably damaging 1.00
R9346:Cacna1d UTSW 14 29,818,880 (GRCm39) missense possibly damaging 0.86
R9444:Cacna1d UTSW 14 29,829,741 (GRCm39) critical splice donor site probably null
R9487:Cacna1d UTSW 14 29,845,419 (GRCm39) missense possibly damaging 0.90
R9542:Cacna1d UTSW 14 29,845,316 (GRCm39) missense probably benign 0.00
R9651:Cacna1d UTSW 14 29,764,881 (GRCm39) missense probably benign 0.00
R9785:Cacna1d UTSW 14 29,824,300 (GRCm39) critical splice donor site probably null
Z1176:Cacna1d UTSW 14 29,833,073 (GRCm39) missense probably benign 0.15
Z1176:Cacna1d UTSW 14 29,901,145 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTTAAGAAAGGCCTGGCGAATG -3'
(R):5'- ACTATCTGACTCGGGACTGG -3'

Sequencing Primer
(F):5'- GGCCTGGCGAATGTAGATTAG -3'
(R):5'- ATCTGACTCGGGACTGGTCTATTC -3'
Posted On 2017-01-03