Incidental Mutation 'R5712:Rnf17'
ID450971
Institutional Source Beutler Lab
Gene Symbol Rnf17
Ensembl Gene ENSMUSG00000000365
Gene Namering finger protein 17
SynonymsMMIP-2
MMRRC Submission 043334-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.453) question?
Stock #R5712 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location56402581-56525032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 56471399 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 759 (V759I)
Ref Sequence ENSEMBL: ENSMUSP00000093469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095793]
Predicted Effect probably benign
Transcript: ENSMUST00000095793
AA Change: V759I

PolyPhen 2 Score 0.193 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000093469
Gene: ENSMUSG00000000365
AA Change: V759I

DomainStartEndE-ValueType
Blast:RING 9 72 2e-15 BLAST
low complexity region 398 405 N/A INTRINSIC
Pfam:TUDOR 440 522 8.2e-8 PFAM
TUDOR 750 807 4.32e-12 SMART
low complexity region 824 836 N/A INTRINSIC
Blast:TUDOR 850 882 1e-8 BLAST
low complexity region 959 970 N/A INTRINSIC
TUDOR 984 1042 1.29e-1 SMART
low complexity region 1128 1139 N/A INTRINSIC
TUDOR 1245 1301 7.7e-9 SMART
low complexity region 1416 1430 N/A INTRINSIC
TUDOR 1495 1554 1e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225621
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a testis-specific protein containing a RING finger domain. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display male infertility, azoospermia, arrest of spermatogenesis, and small testis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 145,044,753 T133A probably benign Het
Adcy8 C T 15: 64,754,866 E708K probably damaging Het
Alkbh1 A G 12: 87,429,113 C300R probably benign Het
Arhgap11a T C 2: 113,845,301 N52D probably benign Het
Ash1l T A 3: 89,051,990 S2225T probably damaging Het
Aspn A T 13: 49,563,519 Y257F probably damaging Het
Atp2b4 A C 1: 133,730,540 V544G probably damaging Het
Bclaf1 T G 10: 20,333,531 Y498D probably damaging Het
Cacna1d A G 14: 30,074,997 I1520T probably damaging Het
Cfap57 G T 4: 118,614,795 P129Q probably damaging Het
Clcn3 A G 8: 60,937,298 probably null Het
Epx A T 11: 87,874,853 Y93* probably null Het
Erich6b T A 14: 75,658,900 D75E possibly damaging Het
Exoc3l4 T A 12: 111,424,042 Y350* probably null Het
Fam13a T A 6: 58,956,699 D302V probably damaging Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Fga C T 3: 83,033,133 T698I possibly damaging Het
Fsip2 T C 2: 83,008,848 S6987P possibly damaging Het
Gatsl3 T C 11: 4,218,378 L22P probably damaging Het
Gbp9 T A 5: 105,094,555 N106I possibly damaging Het
Gls T A 1: 52,196,752 K401N probably damaging Het
Gpatch2l A G 12: 86,244,480 K146E probably damaging Het
Gpr3 A G 4: 133,210,408 S318P probably benign Het
Kbtbd7 T C 14: 79,428,765 V679A possibly damaging Het
Kcnu1 T A 8: 25,919,650 L127H probably damaging Het
Lck G T 4: 129,556,310 H214Q probably benign Het
Lrch4 A C 5: 137,637,926 S380R possibly damaging Het
Lrrk2 A T 15: 91,702,222 K414* probably null Het
Med11 A G 11: 70,453,232 E126G probably damaging Het
Mknk1 A G 4: 115,855,006 probably null Het
Mst1 T C 9: 108,082,908 C355R probably damaging Het
Myl10 T C 5: 136,694,238 F14L probably damaging Het
Nfrkb C T 9: 31,414,636 T1125M probably benign Het
Nin T C 12: 70,042,769 T1291A probably damaging Het
Pcnt T C 10: 76,429,271 Q335R probably damaging Het
Phc2 A G 4: 128,745,095 T83A probably damaging Het
Rdh19 T A 10: 127,856,887 M141K probably benign Het
Sirt7 A T 11: 120,620,851 Y18* probably null Het
Slc27a5 T C 7: 12,998,083 probably benign Het
Soga1 T A 2: 157,030,921 E890V probably damaging Het
Synpo2 T A 3: 123,121,210 I56F probably damaging Het
Tdrd6 C A 17: 43,626,408 G1250C probably damaging Het
Tmem190 G A 7: 4,784,289 G164D probably damaging Het
Tmem57 A T 4: 134,828,058 M368K probably benign Het
Tmigd1 T C 11: 76,907,032 Y67H probably damaging Het
Trim3 T A 7: 105,619,536 E70D probably damaging Het
Uap1 A G 1: 170,166,845 F21L possibly damaging Het
Vmn1r176 A T 7: 23,835,500 V76D probably benign Het
Vps13d A C 4: 145,087,173 S3245A probably benign Het
Wnt7a T C 6: 91,366,204 Y232C probably damaging Het
Zan A G 5: 137,400,098 V4224A unknown Het
Other mutations in Rnf17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Rnf17 APN 14 56421082 missense probably damaging 0.99
IGL00717:Rnf17 APN 14 56465750 missense probably benign 0.00
IGL00978:Rnf17 APN 14 56512271 missense probably damaging 1.00
IGL01295:Rnf17 APN 14 56463064 nonsense probably null
IGL01779:Rnf17 APN 14 56462063 missense probably benign 0.06
IGL02132:Rnf17 APN 14 56421166 missense probably benign 0.27
IGL02183:Rnf17 APN 14 56507868 missense probably null 0.99
IGL02387:Rnf17 APN 14 56500587 missense probably damaging 1.00
IGL02422:Rnf17 APN 14 56482135 missense probably damaging 1.00
IGL03081:Rnf17 APN 14 56434371 missense probably benign 0.03
IGL03269:Rnf17 APN 14 56427946 missense possibly damaging 0.74
R0046:Rnf17 UTSW 14 56471373 missense probably damaging 1.00
R0046:Rnf17 UTSW 14 56471373 missense probably damaging 1.00
R0089:Rnf17 UTSW 14 56514106 missense probably damaging 1.00
R0189:Rnf17 UTSW 14 56482193 missense probably null 1.00
R0243:Rnf17 UTSW 14 56482084 missense possibly damaging 0.80
R0245:Rnf17 UTSW 14 56438609 missense probably damaging 0.97
R0486:Rnf17 UTSW 14 56514175 missense probably benign 0.43
R0554:Rnf17 UTSW 14 56522550 missense probably damaging 1.00
R0840:Rnf17 UTSW 14 56475447 missense probably damaging 1.00
R1169:Rnf17 UTSW 14 56514165 missense possibly damaging 0.89
R1170:Rnf17 UTSW 14 56425631 missense probably benign 0.10
R1200:Rnf17 UTSW 14 56467706 missense probably benign 0.44
R1464:Rnf17 UTSW 14 56461911 missense probably damaging 1.00
R1464:Rnf17 UTSW 14 56461911 missense probably damaging 1.00
R1472:Rnf17 UTSW 14 56427979 missense probably damaging 1.00
R1512:Rnf17 UTSW 14 56467786 missense probably benign 0.01
R1605:Rnf17 UTSW 14 56493365 missense probably damaging 1.00
R1778:Rnf17 UTSW 14 56522399 missense probably damaging 0.99
R1791:Rnf17 UTSW 14 56504007 nonsense probably null
R2015:Rnf17 UTSW 14 56486969 missense probably benign 0.00
R2023:Rnf17 UTSW 14 56431579 missense possibly damaging 0.59
R2086:Rnf17 UTSW 14 56483380 missense probably damaging 0.98
R2130:Rnf17 UTSW 14 56493354 missense probably damaging 1.00
R2309:Rnf17 UTSW 14 56505982 missense possibly damaging 0.95
R3003:Rnf17 UTSW 14 56500547 missense probably damaging 1.00
R3611:Rnf17 UTSW 14 56467740 missense probably benign 0.43
R3847:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3848:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3849:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3850:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3872:Rnf17 UTSW 14 56475413 missense possibly damaging 0.89
R3874:Rnf17 UTSW 14 56475413 missense possibly damaging 0.89
R4021:Rnf17 UTSW 14 56460001 missense probably damaging 0.98
R4022:Rnf17 UTSW 14 56460001 missense probably damaging 0.98
R4790:Rnf17 UTSW 14 56434355 missense probably damaging 1.00
R4951:Rnf17 UTSW 14 56522391 missense probably benign 0.02
R5068:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5069:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5070:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5518:Rnf17 UTSW 14 56482133 missense probably damaging 1.00
R5628:Rnf17 UTSW 14 56486952 splice site probably null
R5747:Rnf17 UTSW 14 56465819 critical splice donor site probably null
R5869:Rnf17 UTSW 14 56505988 missense possibly damaging 0.94
R6336:Rnf17 UTSW 14 56421169 splice site probably null
R6626:Rnf17 UTSW 14 56427924 missense possibly damaging 0.92
R6639:Rnf17 UTSW 14 56438743 missense probably benign 0.01
R6675:Rnf17 UTSW 14 56459975 missense probably damaging 1.00
R6731:Rnf17 UTSW 14 56524350 missense possibly damaging 0.93
R7062:Rnf17 UTSW 14 56465654 missense probably benign 0.00
R7103:Rnf17 UTSW 14 56471306 missense possibly damaging 0.63
R7144:Rnf17 UTSW 14 56512332 splice site probably null
R7527:Rnf17 UTSW 14 56516438 missense probably damaging 1.00
R7664:Rnf17 UTSW 14 56438878 missense probably damaging 1.00
R7754:Rnf17 UTSW 14 56462072 critical splice donor site probably null
R7772:Rnf17 UTSW 14 56477687 missense probably benign 0.27
R8092:Rnf17 UTSW 14 56487022 missense probably benign 0.00
R8150:Rnf17 UTSW 14 56421136 missense probably benign 0.19
R8203:Rnf17 UTSW 14 56467722 missense probably benign 0.17
R8320:Rnf17 UTSW 14 56424542 frame shift probably null
R8321:Rnf17 UTSW 14 56424542 frame shift probably null
R8379:Rnf17 UTSW 14 56424542 frame shift probably null
R8380:Rnf17 UTSW 14 56424542 frame shift probably null
R8381:Rnf17 UTSW 14 56424542 frame shift probably null
R8382:Rnf17 UTSW 14 56424542 frame shift probably null
R8383:Rnf17 UTSW 14 56424542 frame shift probably null
Z1177:Rnf17 UTSW 14 56467706 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GGACACAGACATAATCTAGATGAAC -3'
(R):5'- TGCCTTCTAAAGACGTATGACAGG -3'

Sequencing Primer
(F):5'- ACAGTAAGTTACTTTGTTGAATGGG -3'
(R):5'- CGTATGACAGGGCACATGTTG -3'
Posted On2017-01-03