Mutagenetix > Incidental Mutation

Incidental Mutation 'R5713:Clic3'

450980

Institutional Source

Beutler Lab

Gene Symbol

Clic3

Ensembl Gene

ENSMUSG00000015093

Gene Name

chloride intracellular channel 3

Synonyms

2300003G24Rik

MMRRC Submission

043335-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.156) question?

Stock #

R5713 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25346855-25348789 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 25348179 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 109 (I109F)

Ref Sequence

ENSEMBL: ENSMUSP00000109904 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102918] [ENSMUST00000114261] [ENSMUST00000114265] [ENSMUST00000151239]

AlphaFold

Q9D7P7

Predicted Effect

probably damaging
Transcript: ENSMUST00000102918
AA Change: I107F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000099982
Gene: ENSMUSG00000015093
AA Change: I107F

Domain	Start	End	E-Value	Type
Pfam:GST_N_3	17	89	9.8e-11	PFAM
Pfam:GST_N_2	20	84	1.6e-8	PFAM
Pfam:GST_C_2	77	207	6.3e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000114261

SMART Domains

Protein: ENSMUSP00000109899
Gene: ENSMUSG00000047617

Domain	Start	End	E-Value	Type
Pfam:PAXX	10	205	5.7e-93	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000114265
AA Change: I109F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000109904
Gene: ENSMUSG00000015093
AA Change: I109F

Domain	Start	End	E-Value	Type
Pfam:GST_N_3	19	91	2e-11	PFAM
Pfam:GST_N_2	22	86	3.6e-9	PFAM
Pfam:GST_C_2	80	209	1.2e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123986

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124172

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125710

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128560

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143862

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132311

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140022

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142006

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141613

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132561

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133919

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130130

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135915

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132596

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138079

Predicted Effect

probably benign
Transcript: ENSMUST00000151239

SMART Domains

Protein: ENSMUSP00000120533
Gene: ENSMUSG00000047617

Domain	Start	End	E-Value	Type
Pfam:DUF4610	8	156	2.2e-64	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chloride channels are a diverse group of proteins that regulate fundamental cellular processes including stabilization of cell membrane potential, transepithelial transport, maintenance of intracellular pH, and regulation of cell volume. Chloride intracellular channel 3 is a member of the p64 family and is predominantly localized in the nucleus and stimulates chloride ion channel activity. In addition, this protein may participate in cellular growth control, based on its association with ERK7, a member of the MAP kinase family. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd18	T	A	3: 40,889,414 (GRCm39)	Y431*	probably null	Het
Abtb3	A	T	10: 85,487,516 (GRCm39)	I995F	probably damaging	Het
Aqp7	G	A	4: 41,035,510 (GRCm39)	T115I	probably benign	Het
Arid1b	C	A	17: 5,387,091 (GRCm39)	R1515S	probably damaging	Het
Atp5mc3	A	G	2: 73,739,651 (GRCm39)	V63A	probably benign	Het
Bmp6	C	T	13: 38,682,928 (GRCm39)	P473S	probably damaging	Het
Casp3	C	A	8: 47,089,349 (GRCm39)	T199K	probably damaging	Het
Ccl3	C	T	11: 83,540,066 (GRCm39)	C13Y	possibly damaging	Het
Cdc42bpa	T	C	1: 179,911,975 (GRCm39)	S518P	probably benign	Het
Dnah9	T	A	11: 65,916,049 (GRCm39)	D2301V	possibly damaging	Het
Gm26627	A	G	6: 29,507,850 (GRCm39)		probably benign	Het
Gm4887	A	T	7: 104,471,000 (GRCm39)		noncoding transcript	Het
Hc	A	C	2: 34,903,543 (GRCm39)	I1037S	probably damaging	Het
Il2rb	A	G	15: 78,376,048 (GRCm39)	M1T	probably null	Het
Ing5	T	A	1: 93,740,452 (GRCm39)	D124E	probably benign	Het
Jak2	A	G	19: 29,248,793 (GRCm39)	E90G	probably damaging	Het
Kalrn	A	T	16: 33,836,949 (GRCm39)	I522N	probably benign	Het
Lipa	A	T	19: 34,500,832 (GRCm39)	H71Q	probably benign	Het
Lmnb2	C	T	10: 80,741,921 (GRCm39)	V57M	probably damaging	Het
Mllt3	A	T	4: 87,759,448 (GRCm39)	M200K	probably benign	Het
Mtpap	G	A	18: 4,396,280 (GRCm39)	S524N	probably benign	Het
Mup21	C	G	4: 62,068,511 (GRCm39)	E52Q	probably damaging	Het
Nasp	A	G	4: 116,471,558 (GRCm39)	F90L	probably benign	Het
Nr1d1	T	C	11: 98,661,237 (GRCm39)	D343G	probably benign	Het
Otop2	T	A	11: 115,219,870 (GRCm39)	F237I	probably damaging	Het
Pax4	A	G	6: 28,446,184 (GRCm39)	I103T	probably damaging	Het
Pde4a	T	A	9: 21,114,813 (GRCm39)	S430T	probably damaging	Het
Phf20l1	A	G	15: 66,508,669 (GRCm39)	N843D	possibly damaging	Het
Pla2g7	T	A	17: 43,905,183 (GRCm39)	M37K	probably benign	Het
Plcb3	T	C	19: 6,935,060 (GRCm39)	I864V	probably damaging	Het
Prr16	A	G	18: 51,435,910 (GRCm39)	T130A	probably damaging	Het
Rbm24	A	G	13: 46,582,780 (GRCm39)	D233G	probably damaging	Het
Rps29	C	A	12: 69,205,502 (GRCm39)	R32L	probably benign	Het
Serpind1	A	G	16: 17,154,851 (GRCm39)	E226G	probably damaging	Het
Siglecg	A	T	7: 43,058,226 (GRCm39)	I38F	probably damaging	Het
Slc26a8	T	A	17: 28,880,853 (GRCm39)	M308L	probably benign	Het
Supv3l1	A	G	10: 62,266,283 (GRCm39)	V631A	possibly damaging	Het
Tcf12	T	C	9: 71,792,545 (GRCm39)	*58W	probably null	Het
Trgc2	T	A	13: 19,491,515 (GRCm39)		probably benign	Het
Usp34	T	A	11: 23,293,515 (GRCm39)	V203E	possibly damaging	Het
Vmn2r108	A	G	17: 20,691,290 (GRCm39)	L411P	probably damaging	Het
Zfp874a	A	T	13: 67,597,476 (GRCm39)	D42E	probably benign	Het

Other mutations in Clic3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
knife	UTSW	2	25,347,779 (GRCm39)	missense	possibly damaging	0.94
R0491:Clic3	UTSW	2	25,347,797 (GRCm39)	unclassified	probably benign
R0533:Clic3	UTSW	2	25,348,150 (GRCm39)	missense	probably damaging	1.00
R4798:Clic3	UTSW	2	25,348,194 (GRCm39)	missense	probably damaging	1.00
R4940:Clic3	UTSW	2	25,347,929 (GRCm39)	missense	probably benign	0.00
R5579:Clic3	UTSW	2	25,348,319 (GRCm39)	missense	probably damaging	0.99
R6669:Clic3	UTSW	2	25,347,779 (GRCm39)	missense	possibly damaging	0.94
R7169:Clic3	UTSW	2	25,348,731 (GRCm39)	missense	probably benign	0.02
R8033:Clic3	UTSW	2	25,348,617 (GRCm39)	missense	probably benign	0.00
R9131:Clic3	UTSW	2	25,348,325 (GRCm39)	missense	probably benign	0.00
R9457:Clic3	UTSW	2	25,347,730 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACCTGAGTGAGCATCTGATG -3'
(R):5'- TGGGACTCACGAAGATGTGG -3'

Sequencing Primer
(F):5'- CATCTGATGGGGTGGGCAG -3'
(R):5'- ACTCACGAAGATGTGGCTCCTG -3'

Posted On

2017-01-03