Mutagenetix > Incidental Mutations

Incidental Mutation 'R5713:Bmp6'

451010

Institutional Source

Beutler Lab

Gene Symbol

Bmp6

Ensembl Gene

ENSMUSG00000039004

Gene Name

bone morphogenetic protein 6

Synonyms

Vgr1, D13Wsu115e

MMRRC Submission

043335-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5713 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

38345107-38500302 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 38498952 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 473 (P473S)

Ref Sequence

ENSEMBL: ENSMUSP00000126999 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035988] [ENSMUST00000160653] [ENSMUST00000162075] [ENSMUST00000171970]

Predicted Effect

probably benign
Transcript: ENSMUST00000035988

SMART Domains

Protein: ENSMUSP00000041839
Gene: ENSMUSG00000038991

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
Pfam:Thioredoxin	49	153	5.3e-28	PFAM
low complexity region	156	172	N/A	INTRINSIC
Pfam:Thioredoxin	176	279	2.8e-30	PFAM
Pfam:Thioredoxin	308	412	6.2e-32	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160046

Predicted Effect

probably benign
Transcript: ENSMUST00000160653

SMART Domains

Protein: ENSMUSP00000124401
Gene: ENSMUSG00000038991

Domain	Start	End	E-Value	Type
Pfam:Thioredoxin	1	80	6.3e-22	PFAM
low complexity region	83	99	N/A	INTRINSIC
Pfam:Thioredoxin	103	206	4.2e-31	PFAM
Pfam:Thioredoxin	235	339	3.9e-32	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000162075

SMART Domains

Protein: ENSMUSP00000124516
Gene: ENSMUSG00000038991

Domain	Start	End	E-Value	Type
Pfam:Thioredoxin	1	59	1.5e-13	PFAM
low complexity region	62	78	N/A	INTRINSIC
Pfam:Thioredoxin	82	185	5e-31	PFAM
Pfam:Thioredoxin	214	318	4.6e-32	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000171970
AA Change: P473S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126999
Gene: ENSMUSG00000039004
AA Change: P473S

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:TGFb_propeptide	56	359	2.3e-100	PFAM
low complexity region	368	389	N/A	INTRINSIC
TGFB	409	510	6.8e-71	SMART

Meta Mutation Damage Score

0.4961

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates a wide range of biological processes including iron homeostasis, fat and bone development, and ovulation. Mice lacking this gene exhibit delayed ossification of the sternum, iron overload, and reduced fertility in females. [provided by RefSeq, Jul 2016]
PHENOTYPE: One homozygous null mutant showed delayed ossification in the developing sternum while females of a second null mutant were smaller than normal in size. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd18	T	A	3: 40,934,979	Y431*	probably null	Het
Aqp7	G	A	4: 41,035,510	T115I	probably benign	Het
Arid1b	C	A	17: 5,336,816	R1515S	probably damaging	Het
Atp5g3	A	G	2: 73,909,307	V63A	probably benign	Het
Btbd11	A	T	10: 85,651,652	I995F	probably damaging	Het
Casp3	C	A	8: 46,636,314	T199K	probably damaging	Het
Ccl3	C	T	11: 83,649,240	C13Y	possibly damaging	Het
Cdc42bpa	T	C	1: 180,084,410	S518P	probably benign	Het
Clic3	A	T	2: 25,458,167	I109F	probably damaging	Het
Dnah9	T	A	11: 66,025,223	D2301V	possibly damaging	Het
Gm26627	A	G	6: 29,507,851		probably benign	Het
Gm4887	A	T	7: 104,821,793		noncoding transcript	Het
Hc	A	C	2: 35,013,531	I1037S	probably damaging	Het
Il2rb	A	G	15: 78,491,848	M1T	probably null	Het
Ing5	T	A	1: 93,812,730	D124E	probably benign	Het
Jak2	A	G	19: 29,271,393	E90G	probably damaging	Het
Kalrn	A	T	16: 34,016,579	I522N	probably benign	Het
Lipa	A	T	19: 34,523,432	H71Q	probably benign	Het
Lmnb2	C	T	10: 80,906,087	V57M	probably damaging	Het
Mllt3	A	T	4: 87,841,211	M200K	probably benign	Het
Mtpap	G	A	18: 4,396,280	S524N	probably benign	Het
Mup21	C	G	4: 62,150,274	E52Q	probably damaging	Het
Nasp	A	G	4: 116,614,361	F90L	probably benign	Het
Nr1d1	T	C	11: 98,770,411	D343G	probably benign	Het
Otop2	T	A	11: 115,329,044	F237I	probably damaging	Het
Pax4	A	G	6: 28,446,185	I103T	probably damaging	Het
Pde4a	T	A	9: 21,203,517	S430T	probably damaging	Het
Phf20l1	A	G	15: 66,636,820	N843D	possibly damaging	Het
Pla2g7	T	A	17: 43,594,292	M37K	probably benign	Het
Plcb3	T	C	19: 6,957,692	I864V	probably damaging	Het
Prr16	A	G	18: 51,302,838	T130A	probably damaging	Het
Rbm24	A	G	13: 46,429,304	D233G	probably damaging	Het
Rps29	C	A	12: 69,158,728	R32L	probably benign	Het
Serpind1	A	G	16: 17,336,987	E226G	probably damaging	Het
Siglecg	A	T	7: 43,408,802	I38F	probably damaging	Het
Slc26a8	T	A	17: 28,661,879	M308L	probably benign	Het
Supv3l1	A	G	10: 62,430,504	V631A	possibly damaging	Het
Tcf12	T	C	9: 71,885,263	*58W	probably null	Het
Tcrg-C2	T	A	13: 19,307,345		probably benign	Het
Usp34	T	A	11: 23,343,515	V203E	possibly damaging	Het
Vmn2r108	A	G	17: 20,471,028	L411P	probably damaging	Het
Zfp874a	A	T	13: 67,449,357	D42E	probably benign	Het

Other mutations in Bmp6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01351:Bmp6	APN	13	38469634	missense	probably damaging	0.99
IGL01409:Bmp6	APN	13	38485889	missense	probably damaging	1.00
IGL01646:Bmp6	APN	13	38498928	missense	probably damaging	0.99
IGL01823:Bmp6	APN	13	38498822	missense	probably damaging	1.00
IGL03000:Bmp6	APN	13	38498911	splice site	probably benign
IGL03337:Bmp6	APN	13	38498943	missense	probably damaging	1.00
PIT4431001:Bmp6	UTSW	13	38485930	missense	probably benign
R1218:Bmp6	UTSW	13	38346250	small deletion	probably benign
R1225:Bmp6	UTSW	13	38346281	missense	probably benign
R4579:Bmp6	UTSW	13	38469725	missense	probably damaging	1.00
R4834:Bmp6	UTSW	13	38485841	missense	probably damaging	1.00
R5208:Bmp6	UTSW	13	38469697	missense	probably benign	0.23
R5842:Bmp6	UTSW	13	38346567	missense	probably damaging	0.99
R6319:Bmp6	UTSW	13	38346414	missense	probably benign	0.28
R7348:Bmp6	UTSW	13	38485903	missense	probably benign	0.00
R7565:Bmp6	UTSW	13	38346257	nonsense	probably null
R7669:Bmp6	UTSW	13	38484920	missense	probably damaging	0.98
R7681:Bmp6	UTSW	13	38346195	missense	probably damaging	1.00
R7834:Bmp6	UTSW	13	38469667	missense	probably damaging	1.00
R7917:Bmp6	UTSW	13	38469667	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATTGCACCCAAAGGCTACG -3'
(R):5'- TTGTTAGGAATCCAAGGCAGAAC -3'

Sequencing Primer
(F):5'- TACGCTGCCAACTACTGTGATGG -3'
(R):5'- TAGGAATCCAAGGCAGAACCATGC -3'

Posted On

2017-01-03