Incidental Mutation 'R5713:Bmp6'
ID451010
Institutional Source Beutler Lab
Gene Symbol Bmp6
Ensembl Gene ENSMUSG00000039004
Gene Namebone morphogenetic protein 6
SynonymsVgr1, D13Wsu115e
MMRRC Submission 043335-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5713 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location38345107-38500302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 38498952 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 473 (P473S)
Ref Sequence ENSEMBL: ENSMUSP00000126999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035988] [ENSMUST00000160653] [ENSMUST00000162075] [ENSMUST00000171970]
Predicted Effect probably benign
Transcript: ENSMUST00000035988
SMART Domains Protein: ENSMUSP00000041839
Gene: ENSMUSG00000038991

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Thioredoxin 49 153 5.3e-28 PFAM
low complexity region 156 172 N/A INTRINSIC
Pfam:Thioredoxin 176 279 2.8e-30 PFAM
Pfam:Thioredoxin 308 412 6.2e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160046
Predicted Effect probably benign
Transcript: ENSMUST00000160653
SMART Domains Protein: ENSMUSP00000124401
Gene: ENSMUSG00000038991

DomainStartEndE-ValueType
Pfam:Thioredoxin 1 80 6.3e-22 PFAM
low complexity region 83 99 N/A INTRINSIC
Pfam:Thioredoxin 103 206 4.2e-31 PFAM
Pfam:Thioredoxin 235 339 3.9e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162075
SMART Domains Protein: ENSMUSP00000124516
Gene: ENSMUSG00000038991

DomainStartEndE-ValueType
Pfam:Thioredoxin 1 59 1.5e-13 PFAM
low complexity region 62 78 N/A INTRINSIC
Pfam:Thioredoxin 82 185 5e-31 PFAM
Pfam:Thioredoxin 214 318 4.6e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171970
AA Change: P473S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126999
Gene: ENSMUSG00000039004
AA Change: P473S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TGFb_propeptide 56 359 2.3e-100 PFAM
low complexity region 368 389 N/A INTRINSIC
TGFB 409 510 6.8e-71 SMART
Meta Mutation Damage Score 0.4961 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates a wide range of biological processes including iron homeostasis, fat and bone development, and ovulation. Mice lacking this gene exhibit delayed ossification of the sternum, iron overload, and reduced fertility in females. [provided by RefSeq, Jul 2016]
PHENOTYPE: One homozygous null mutant showed delayed ossification in the developing sternum while females of a second null mutant were smaller than normal in size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 T A 3: 40,934,979 Y431* probably null Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arid1b C A 17: 5,336,816 R1515S probably damaging Het
Atp5g3 A G 2: 73,909,307 V63A probably benign Het
Btbd11 A T 10: 85,651,652 I995F probably damaging Het
Casp3 C A 8: 46,636,314 T199K probably damaging Het
Ccl3 C T 11: 83,649,240 C13Y possibly damaging Het
Cdc42bpa T C 1: 180,084,410 S518P probably benign Het
Clic3 A T 2: 25,458,167 I109F probably damaging Het
Dnah9 T A 11: 66,025,223 D2301V possibly damaging Het
Gm26627 A G 6: 29,507,851 probably benign Het
Gm4887 A T 7: 104,821,793 noncoding transcript Het
Hc A C 2: 35,013,531 I1037S probably damaging Het
Il2rb A G 15: 78,491,848 M1T probably null Het
Ing5 T A 1: 93,812,730 D124E probably benign Het
Jak2 A G 19: 29,271,393 E90G probably damaging Het
Kalrn A T 16: 34,016,579 I522N probably benign Het
Lipa A T 19: 34,523,432 H71Q probably benign Het
Lmnb2 C T 10: 80,906,087 V57M probably damaging Het
Mllt3 A T 4: 87,841,211 M200K probably benign Het
Mtpap G A 18: 4,396,280 S524N probably benign Het
Mup21 C G 4: 62,150,274 E52Q probably damaging Het
Nasp A G 4: 116,614,361 F90L probably benign Het
Nr1d1 T C 11: 98,770,411 D343G probably benign Het
Otop2 T A 11: 115,329,044 F237I probably damaging Het
Pax4 A G 6: 28,446,185 I103T probably damaging Het
Pde4a T A 9: 21,203,517 S430T probably damaging Het
Phf20l1 A G 15: 66,636,820 N843D possibly damaging Het
Pla2g7 T A 17: 43,594,292 M37K probably benign Het
Plcb3 T C 19: 6,957,692 I864V probably damaging Het
Prr16 A G 18: 51,302,838 T130A probably damaging Het
Rbm24 A G 13: 46,429,304 D233G probably damaging Het
Rps29 C A 12: 69,158,728 R32L probably benign Het
Serpind1 A G 16: 17,336,987 E226G probably damaging Het
Siglecg A T 7: 43,408,802 I38F probably damaging Het
Slc26a8 T A 17: 28,661,879 M308L probably benign Het
Supv3l1 A G 10: 62,430,504 V631A possibly damaging Het
Tcf12 T C 9: 71,885,263 *58W probably null Het
Tcrg-C2 T A 13: 19,307,345 probably benign Het
Usp34 T A 11: 23,343,515 V203E possibly damaging Het
Vmn2r108 A G 17: 20,471,028 L411P probably damaging Het
Zfp874a A T 13: 67,449,357 D42E probably benign Het
Other mutations in Bmp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01351:Bmp6 APN 13 38469634 missense probably damaging 0.99
IGL01409:Bmp6 APN 13 38485889 missense probably damaging 1.00
IGL01646:Bmp6 APN 13 38498928 missense probably damaging 0.99
IGL01823:Bmp6 APN 13 38498822 missense probably damaging 1.00
IGL03000:Bmp6 APN 13 38498911 splice site probably benign
IGL03337:Bmp6 APN 13 38498943 missense probably damaging 1.00
PIT4431001:Bmp6 UTSW 13 38485930 missense probably benign
R1218:Bmp6 UTSW 13 38346250 small deletion probably benign
R1225:Bmp6 UTSW 13 38346281 missense probably benign
R4579:Bmp6 UTSW 13 38469725 missense probably damaging 1.00
R4834:Bmp6 UTSW 13 38485841 missense probably damaging 1.00
R5208:Bmp6 UTSW 13 38469697 missense probably benign 0.23
R5842:Bmp6 UTSW 13 38346567 missense probably damaging 0.99
R6319:Bmp6 UTSW 13 38346414 missense probably benign 0.28
R7348:Bmp6 UTSW 13 38485903 missense probably benign 0.00
R7565:Bmp6 UTSW 13 38346257 nonsense probably null
R7669:Bmp6 UTSW 13 38484920 missense probably damaging 0.98
R7681:Bmp6 UTSW 13 38346195 missense probably damaging 1.00
R7834:Bmp6 UTSW 13 38469667 missense probably damaging 1.00
R7917:Bmp6 UTSW 13 38469667 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTGCACCCAAAGGCTACG -3'
(R):5'- TTGTTAGGAATCCAAGGCAGAAC -3'

Sequencing Primer
(F):5'- TACGCTGCCAACTACTGTGATGG -3'
(R):5'- TAGGAATCCAAGGCAGAACCATGC -3'
Posted On2017-01-03