Mutagenetix > Incidental Mutation

Incidental Mutation 'R5713:Phf20l1'

451014

Institutional Source

Beutler Lab

Gene Symbol

Phf20l1

Ensembl Gene

ENSMUSG00000072501

Gene Name

PHD finger protein 20-like 1

Synonyms

CGI-72, E130113K22Rik

MMRRC Submission

043335-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.212) question?

Stock #

R5713 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

66577560-66647976 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 66636820 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 843 (N843D)

Ref Sequence

ENSEMBL: ENSMUSP00000035682 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048188] [ENSMUST00000229160] [ENSMUST00000229576] [ENSMUST00000230948]

AlphaFold

Q8CCJ9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000048188
AA Change: N843D

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000035682
Gene: ENSMUSG00000072501
AA Change: N843D

Domain	Start	End	E-Value	Type
TUDOR	11	71	7.67e0	SMART
Agenet	11	73	3.53e0	SMART
Agenet	85	141	4.54e-1	SMART
TUDOR	85	141	5.75e-8	SMART
Pfam:DUF3776	210	319	1.3e-31	PFAM
Pfam:PHD20L1_u1	318	413	4.7e-47	PFAM
low complexity region	443	453	N/A	INTRINSIC
low complexity region	530	543	N/A	INTRINSIC
low complexity region	547	585	N/A	INTRINSIC
low complexity region	598	608	N/A	INTRINSIC
low complexity region	642	658	N/A	INTRINSIC
PHD	683	727	8.45e-3	SMART
low complexity region	879	887	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229033

Predicted Effect

possibly damaging
Transcript: ENSMUST00000229160
AA Change: N842D

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)

Predicted Effect

probably benign
Transcript: ENSMUST00000229576

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230250

Predicted Effect

possibly damaging
Transcript: ENSMUST00000230948
AA Change: N816D

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231177

Meta Mutation Damage Score

0.0603

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

98% (56/57)

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd18	T	A	3: 40,934,979	Y431*	probably null	Het
Aqp7	G	A	4: 41,035,510	T115I	probably benign	Het
Arid1b	C	A	17: 5,336,816	R1515S	probably damaging	Het
Atp5g3	A	G	2: 73,909,307	V63A	probably benign	Het
Bmp6	C	T	13: 38,498,952	P473S	probably damaging	Het
Btbd11	A	T	10: 85,651,652	I995F	probably damaging	Het
Casp3	C	A	8: 46,636,314	T199K	probably damaging	Het
Ccl3	C	T	11: 83,649,240	C13Y	possibly damaging	Het
Cdc42bpa	T	C	1: 180,084,410	S518P	probably benign	Het
Clic3	A	T	2: 25,458,167	I109F	probably damaging	Het
Dnah9	T	A	11: 66,025,223	D2301V	possibly damaging	Het
Gm26627	A	G	6: 29,507,851		probably benign	Het
Gm4887	A	T	7: 104,821,793		noncoding transcript	Het
Hc	A	C	2: 35,013,531	I1037S	probably damaging	Het
Il2rb	A	G	15: 78,491,848	M1T	probably null	Het
Ing5	T	A	1: 93,812,730	D124E	probably benign	Het
Jak2	A	G	19: 29,271,393	E90G	probably damaging	Het
Kalrn	A	T	16: 34,016,579	I522N	probably benign	Het
Lipa	A	T	19: 34,523,432	H71Q	probably benign	Het
Lmnb2	C	T	10: 80,906,087	V57M	probably damaging	Het
Mllt3	A	T	4: 87,841,211	M200K	probably benign	Het
Mtpap	G	A	18: 4,396,280	S524N	probably benign	Het
Mup21	C	G	4: 62,150,274	E52Q	probably damaging	Het
Nasp	A	G	4: 116,614,361	F90L	probably benign	Het
Nr1d1	T	C	11: 98,770,411	D343G	probably benign	Het
Otop2	T	A	11: 115,329,044	F237I	probably damaging	Het
Pax4	A	G	6: 28,446,185	I103T	probably damaging	Het
Pde4a	T	A	9: 21,203,517	S430T	probably damaging	Het
Pla2g7	T	A	17: 43,594,292	M37K	probably benign	Het
Plcb3	T	C	19: 6,957,692	I864V	probably damaging	Het
Prr16	A	G	18: 51,302,838	T130A	probably damaging	Het
Rbm24	A	G	13: 46,429,304	D233G	probably damaging	Het
Rps29	C	A	12: 69,158,728	R32L	probably benign	Het
Serpind1	A	G	16: 17,336,987	E226G	probably damaging	Het
Siglecg	A	T	7: 43,408,802	I38F	probably damaging	Het
Slc26a8	T	A	17: 28,661,879	M308L	probably benign	Het
Supv3l1	A	G	10: 62,430,504	V631A	possibly damaging	Het
Tcf12	T	C	9: 71,885,263	*58W	probably null	Het
Tcrg-C2	T	A	13: 19,307,345		probably benign	Het
Usp34	T	A	11: 23,343,515	V203E	possibly damaging	Het
Vmn2r108	A	G	17: 20,471,028	L411P	probably damaging	Het
Zfp874a	A	T	13: 67,449,357	D42E	probably benign	Het

Other mutations in Phf20l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Phf20l1	APN	15	66629035	missense	probably benign	0.28
IGL00484:Phf20l1	APN	15	66615633	splice site	probably benign
IGL00668:Phf20l1	APN	15	66632849	missense	probably damaging	0.99
IGL00849:Phf20l1	APN	15	66636832	missense	probably benign	0.00
IGL00954:Phf20l1	APN	15	66641908	missense	probably damaging	1.00
IGL01025:Phf20l1	APN	15	66613132	missense	probably damaging	1.00
IGL01504:Phf20l1	APN	15	66597691	missense	possibly damaging	0.73
IGL02087:Phf20l1	APN	15	66628991	missense	probably damaging	1.00
IGL02273:Phf20l1	APN	15	66640025	missense	probably damaging	1.00
IGL02276:Phf20l1	APN	15	66615410	critical splice donor site	probably null
IGL02372:Phf20l1	APN	15	66641801	missense	probably damaging	1.00
IGL02589:Phf20l1	APN	15	66615632	splice site	probably benign
IGL02656:Phf20l1	APN	15	66629827	missense	probably damaging	1.00
IGL02691:Phf20l1	APN	15	66604864	missense	probably damaging	1.00
IGL02881:Phf20l1	APN	15	66594980	critical splice donor site	probably null
IGL02940:Phf20l1	APN	15	66595151	missense	probably damaging	1.00
IGL02943:Phf20l1	APN	15	66594884	missense	probably damaging	1.00
IGL03030:Phf20l1	APN	15	66641947	utr 3 prime	probably benign
IGL03034:Phf20l1	APN	15	66597403	missense	probably damaging	1.00
Abbreviated	UTSW	15	66632903	critical splice donor site	probably null
acadia	UTSW	15	66636820	missense	possibly damaging	0.85
curt	UTSW	15	66639948	missense	possibly damaging	0.90
Cut	UTSW	15	66613039	nonsense	probably null
shorthand	UTSW	15	66609547	missense	probably damaging	1.00
slang	UTSW	15	66641932	missense	probably benign	0.03
PIT4305001:Phf20l1	UTSW	15	66613052	missense	possibly damaging	0.94
R0070:Phf20l1	UTSW	15	66639991	missense	probably damaging	1.00
R0070:Phf20l1	UTSW	15	66639991	missense	probably damaging	1.00
R0562:Phf20l1	UTSW	15	66609604	missense	probably damaging	1.00
R0605:Phf20l1	UTSW	15	66595122	missense	probably damaging	1.00
R0787:Phf20l1	UTSW	15	66615630	splice site	probably benign
R1458:Phf20l1	UTSW	15	66604813	missense	probably damaging	1.00
R1619:Phf20l1	UTSW	15	66615259	missense	possibly damaging	0.88
R1781:Phf20l1	UTSW	15	66632825	missense	probably damaging	1.00
R2360:Phf20l1	UTSW	15	66594920	missense	probably damaging	1.00
R3973:Phf20l1	UTSW	15	66641816	missense	probably damaging	1.00
R4374:Phf20l1	UTSW	15	66604837	missense	possibly damaging	0.72
R4375:Phf20l1	UTSW	15	66615222	missense	probably benign	0.00
R4554:Phf20l1	UTSW	15	66597367	missense	probably damaging	1.00
R4913:Phf20l1	UTSW	15	66604855	missense	probably benign	0.03
R5092:Phf20l1	UTSW	15	66636913	missense	possibly damaging	0.46
R5491:Phf20l1	UTSW	15	66615785	missense	possibly damaging	0.67
R6126:Phf20l1	UTSW	15	66636824	missense	probably benign	0.02
R6213:Phf20l1	UTSW	15	66632903	critical splice donor site	probably null
R6569:Phf20l1	UTSW	15	66629824	missense	probably damaging	1.00
R6572:Phf20l1	UTSW	15	66609547	missense	probably damaging	1.00
R6808:Phf20l1	UTSW	15	66630913	missense	probably damaging	0.99
R7100:Phf20l1	UTSW	15	66604840	missense	probably benign	0.01
R7208:Phf20l1	UTSW	15	66604789	missense	probably benign	0.05
R7436:Phf20l1	UTSW	15	66597750	missense	possibly damaging	0.92
R7466:Phf20l1	UTSW	15	66636884	missense	probably damaging	1.00
R7604:Phf20l1	UTSW	15	66604084	missense	probably benign	0.02
R7863:Phf20l1	UTSW	15	66615235	missense	possibly damaging	0.94
R7991:Phf20l1	UTSW	15	66630919	missense	possibly damaging	0.64
R8015:Phf20l1	UTSW	15	66639948	missense	possibly damaging	0.90
R8161:Phf20l1	UTSW	15	66604073	missense	probably damaging	1.00
R8228:Phf20l1	UTSW	15	66639940	missense	possibly damaging	0.81
R8857:Phf20l1	UTSW	15	66641932	missense	probably benign	0.03
R9295:Phf20l1	UTSW	15	66641903	missense	probably damaging	1.00
R9393:Phf20l1	UTSW	15	66604106	missense	probably damaging	1.00
R9442:Phf20l1	UTSW	15	66613039	nonsense	probably null
R9522:Phf20l1	UTSW	15	66632820	missense	possibly damaging	0.89
R9727:Phf20l1	UTSW	15	66615382	missense	probably benign	0.01
X0065:Phf20l1	UTSW	15	66597678	missense	probably damaging	0.99
X0065:Phf20l1	UTSW	15	66629806	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GACAACTTCGTCTTTGATCCTGAC -3'
(R):5'- TTATCTGGCACACGGAGCTC -3'

Sequencing Primer
(F):5'- ACCACAATTTTTAGCGTGTTGC -3'
(R):5'- GGAGCTCCCCATCTTCTTCAAAAC -3'

Posted On

2017-01-03