Incidental Mutation 'R5713:Phf20l1'
ID 451014
Institutional Source Beutler Lab
Gene Symbol Phf20l1
Ensembl Gene ENSMUSG00000072501
Gene Name PHD finger protein 20-like 1
Synonyms E130113K22Rik, CGI-72
MMRRC Submission 043335-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.197) question?
Stock # R5713 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 66449409-66519825 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 66508669 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 843 (N843D)
Ref Sequence ENSEMBL: ENSMUSP00000035682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048188] [ENSMUST00000229160] [ENSMUST00000229576] [ENSMUST00000230948]
AlphaFold Q8CCJ9
Predicted Effect possibly damaging
Transcript: ENSMUST00000048188
AA Change: N843D

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000035682
Gene: ENSMUSG00000072501
AA Change: N843D

DomainStartEndE-ValueType
TUDOR 11 71 7.67e0 SMART
Agenet 11 73 3.53e0 SMART
Agenet 85 141 4.54e-1 SMART
TUDOR 85 141 5.75e-8 SMART
Pfam:DUF3776 210 319 1.3e-31 PFAM
Pfam:PHD20L1_u1 318 413 4.7e-47 PFAM
low complexity region 443 453 N/A INTRINSIC
low complexity region 530 543 N/A INTRINSIC
low complexity region 547 585 N/A INTRINSIC
low complexity region 598 608 N/A INTRINSIC
low complexity region 642 658 N/A INTRINSIC
PHD 683 727 8.45e-3 SMART
low complexity region 879 887 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229033
Predicted Effect possibly damaging
Transcript: ENSMUST00000229160
AA Change: N842D

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000229576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230250
Predicted Effect possibly damaging
Transcript: ENSMUST00000230948
AA Change: N816D

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231177
Meta Mutation Damage Score 0.0603 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 T A 3: 40,889,414 (GRCm39) Y431* probably null Het
Abtb3 A T 10: 85,487,516 (GRCm39) I995F probably damaging Het
Aqp7 G A 4: 41,035,510 (GRCm39) T115I probably benign Het
Arid1b C A 17: 5,387,091 (GRCm39) R1515S probably damaging Het
Atp5mc3 A G 2: 73,739,651 (GRCm39) V63A probably benign Het
Bmp6 C T 13: 38,682,928 (GRCm39) P473S probably damaging Het
Casp3 C A 8: 47,089,349 (GRCm39) T199K probably damaging Het
Ccl3 C T 11: 83,540,066 (GRCm39) C13Y possibly damaging Het
Cdc42bpa T C 1: 179,911,975 (GRCm39) S518P probably benign Het
Clic3 A T 2: 25,348,179 (GRCm39) I109F probably damaging Het
Dnah9 T A 11: 65,916,049 (GRCm39) D2301V possibly damaging Het
Gm26627 A G 6: 29,507,850 (GRCm39) probably benign Het
Gm4887 A T 7: 104,471,000 (GRCm39) noncoding transcript Het
Hc A C 2: 34,903,543 (GRCm39) I1037S probably damaging Het
Il2rb A G 15: 78,376,048 (GRCm39) M1T probably null Het
Ing5 T A 1: 93,740,452 (GRCm39) D124E probably benign Het
Jak2 A G 19: 29,248,793 (GRCm39) E90G probably damaging Het
Kalrn A T 16: 33,836,949 (GRCm39) I522N probably benign Het
Lipa A T 19: 34,500,832 (GRCm39) H71Q probably benign Het
Lmnb2 C T 10: 80,741,921 (GRCm39) V57M probably damaging Het
Mllt3 A T 4: 87,759,448 (GRCm39) M200K probably benign Het
Mtpap G A 18: 4,396,280 (GRCm39) S524N probably benign Het
Mup21 C G 4: 62,068,511 (GRCm39) E52Q probably damaging Het
Nasp A G 4: 116,471,558 (GRCm39) F90L probably benign Het
Nr1d1 T C 11: 98,661,237 (GRCm39) D343G probably benign Het
Otop2 T A 11: 115,219,870 (GRCm39) F237I probably damaging Het
Pax4 A G 6: 28,446,184 (GRCm39) I103T probably damaging Het
Pde4a T A 9: 21,114,813 (GRCm39) S430T probably damaging Het
Pla2g7 T A 17: 43,905,183 (GRCm39) M37K probably benign Het
Plcb3 T C 19: 6,935,060 (GRCm39) I864V probably damaging Het
Prr16 A G 18: 51,435,910 (GRCm39) T130A probably damaging Het
Rbm24 A G 13: 46,582,780 (GRCm39) D233G probably damaging Het
Rps29 C A 12: 69,205,502 (GRCm39) R32L probably benign Het
Serpind1 A G 16: 17,154,851 (GRCm39) E226G probably damaging Het
Siglecg A T 7: 43,058,226 (GRCm39) I38F probably damaging Het
Slc26a8 T A 17: 28,880,853 (GRCm39) M308L probably benign Het
Supv3l1 A G 10: 62,266,283 (GRCm39) V631A possibly damaging Het
Tcf12 T C 9: 71,792,545 (GRCm39) *58W probably null Het
Trgc2 T A 13: 19,491,515 (GRCm39) probably benign Het
Usp34 T A 11: 23,293,515 (GRCm39) V203E possibly damaging Het
Vmn2r108 A G 17: 20,691,290 (GRCm39) L411P probably damaging Het
Zfp874a A T 13: 67,597,476 (GRCm39) D42E probably benign Het
Other mutations in Phf20l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Phf20l1 APN 15 66,500,884 (GRCm39) missense probably benign 0.28
IGL00484:Phf20l1 APN 15 66,487,482 (GRCm39) splice site probably benign
IGL00668:Phf20l1 APN 15 66,504,698 (GRCm39) missense probably damaging 0.99
IGL00849:Phf20l1 APN 15 66,508,681 (GRCm39) missense probably benign 0.00
IGL00954:Phf20l1 APN 15 66,513,757 (GRCm39) missense probably damaging 1.00
IGL01025:Phf20l1 APN 15 66,484,981 (GRCm39) missense probably damaging 1.00
IGL01504:Phf20l1 APN 15 66,469,540 (GRCm39) missense possibly damaging 0.73
IGL02087:Phf20l1 APN 15 66,500,840 (GRCm39) missense probably damaging 1.00
IGL02273:Phf20l1 APN 15 66,511,874 (GRCm39) missense probably damaging 1.00
IGL02276:Phf20l1 APN 15 66,487,259 (GRCm39) critical splice donor site probably null
IGL02372:Phf20l1 APN 15 66,513,650 (GRCm39) missense probably damaging 1.00
IGL02589:Phf20l1 APN 15 66,487,481 (GRCm39) splice site probably benign
IGL02656:Phf20l1 APN 15 66,501,676 (GRCm39) missense probably damaging 1.00
IGL02691:Phf20l1 APN 15 66,476,713 (GRCm39) missense probably damaging 1.00
IGL02881:Phf20l1 APN 15 66,466,829 (GRCm39) critical splice donor site probably null
IGL02940:Phf20l1 APN 15 66,467,000 (GRCm39) missense probably damaging 1.00
IGL02943:Phf20l1 APN 15 66,466,733 (GRCm39) missense probably damaging 1.00
IGL03030:Phf20l1 APN 15 66,513,796 (GRCm39) utr 3 prime probably benign
IGL03034:Phf20l1 APN 15 66,469,252 (GRCm39) missense probably damaging 1.00
Abbreviated UTSW 15 66,504,752 (GRCm39) critical splice donor site probably null
acadia UTSW 15 66,508,669 (GRCm39) missense possibly damaging 0.85
curt UTSW 15 66,511,797 (GRCm39) missense possibly damaging 0.90
Cut UTSW 15 66,484,888 (GRCm39) nonsense probably null
shorthand UTSW 15 66,481,396 (GRCm39) missense probably damaging 1.00
slang UTSW 15 66,513,781 (GRCm39) missense probably benign 0.03
PIT4305001:Phf20l1 UTSW 15 66,484,901 (GRCm39) missense possibly damaging 0.94
R0070:Phf20l1 UTSW 15 66,511,840 (GRCm39) missense probably damaging 1.00
R0070:Phf20l1 UTSW 15 66,511,840 (GRCm39) missense probably damaging 1.00
R0562:Phf20l1 UTSW 15 66,481,453 (GRCm39) missense probably damaging 1.00
R0605:Phf20l1 UTSW 15 66,466,971 (GRCm39) missense probably damaging 1.00
R0787:Phf20l1 UTSW 15 66,487,479 (GRCm39) splice site probably benign
R1458:Phf20l1 UTSW 15 66,476,662 (GRCm39) missense probably damaging 1.00
R1619:Phf20l1 UTSW 15 66,487,108 (GRCm39) missense possibly damaging 0.88
R1781:Phf20l1 UTSW 15 66,504,674 (GRCm39) missense probably damaging 1.00
R2360:Phf20l1 UTSW 15 66,466,769 (GRCm39) missense probably damaging 1.00
R3973:Phf20l1 UTSW 15 66,513,665 (GRCm39) missense probably damaging 1.00
R4374:Phf20l1 UTSW 15 66,476,686 (GRCm39) missense possibly damaging 0.72
R4375:Phf20l1 UTSW 15 66,487,071 (GRCm39) missense probably benign 0.00
R4554:Phf20l1 UTSW 15 66,469,216 (GRCm39) missense probably damaging 1.00
R4913:Phf20l1 UTSW 15 66,476,704 (GRCm39) missense probably benign 0.03
R5092:Phf20l1 UTSW 15 66,508,762 (GRCm39) missense possibly damaging 0.46
R5491:Phf20l1 UTSW 15 66,487,634 (GRCm39) missense possibly damaging 0.67
R6126:Phf20l1 UTSW 15 66,508,673 (GRCm39) missense probably benign 0.02
R6213:Phf20l1 UTSW 15 66,504,752 (GRCm39) critical splice donor site probably null
R6569:Phf20l1 UTSW 15 66,501,673 (GRCm39) missense probably damaging 1.00
R6572:Phf20l1 UTSW 15 66,481,396 (GRCm39) missense probably damaging 1.00
R6808:Phf20l1 UTSW 15 66,502,762 (GRCm39) missense probably damaging 0.99
R7100:Phf20l1 UTSW 15 66,476,689 (GRCm39) missense probably benign 0.01
R7208:Phf20l1 UTSW 15 66,476,638 (GRCm39) missense probably benign 0.05
R7436:Phf20l1 UTSW 15 66,469,599 (GRCm39) missense possibly damaging 0.92
R7466:Phf20l1 UTSW 15 66,508,733 (GRCm39) missense probably damaging 1.00
R7604:Phf20l1 UTSW 15 66,475,933 (GRCm39) missense probably benign 0.02
R7863:Phf20l1 UTSW 15 66,487,084 (GRCm39) missense possibly damaging 0.94
R7991:Phf20l1 UTSW 15 66,502,768 (GRCm39) missense possibly damaging 0.64
R8015:Phf20l1 UTSW 15 66,511,797 (GRCm39) missense possibly damaging 0.90
R8161:Phf20l1 UTSW 15 66,475,922 (GRCm39) missense probably damaging 1.00
R8228:Phf20l1 UTSW 15 66,511,789 (GRCm39) missense possibly damaging 0.81
R8857:Phf20l1 UTSW 15 66,513,781 (GRCm39) missense probably benign 0.03
R9295:Phf20l1 UTSW 15 66,513,752 (GRCm39) missense probably damaging 1.00
R9393:Phf20l1 UTSW 15 66,475,955 (GRCm39) missense probably damaging 1.00
R9442:Phf20l1 UTSW 15 66,484,888 (GRCm39) nonsense probably null
R9522:Phf20l1 UTSW 15 66,504,669 (GRCm39) missense possibly damaging 0.89
R9727:Phf20l1 UTSW 15 66,487,231 (GRCm39) missense probably benign 0.01
X0065:Phf20l1 UTSW 15 66,501,655 (GRCm39) nonsense probably null
X0065:Phf20l1 UTSW 15 66,469,527 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACAACTTCGTCTTTGATCCTGAC -3'
(R):5'- TTATCTGGCACACGGAGCTC -3'

Sequencing Primer
(F):5'- ACCACAATTTTTAGCGTGTTGC -3'
(R):5'- GGAGCTCCCCATCTTCTTCAAAAC -3'
Posted On 2017-01-03