Incidental Mutation 'R5713:Prr16'
ID451024
Institutional Source Beutler Lab
Gene Symbol Prr16
Ensembl Gene ENSMUSG00000073565
Gene Nameproline rich 16
Synonyms5430406M13Rik
MMRRC Submission 043335-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R5713 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location51117898-51304641 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51302838 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 130 (T130A)
Ref Sequence ENSEMBL: ENSMUSP00000112338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000116639]
Predicted Effect probably damaging
Transcript: ENSMUST00000116639
AA Change: T130A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112338
Gene: ENSMUSG00000073565
AA Change: T130A

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Pfam:DUF4589 53 304 4.4e-80 PFAM
Meta Mutation Damage Score 0.0946 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 T A 3: 40,934,979 Y431* probably null Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arid1b C A 17: 5,336,816 R1515S probably damaging Het
Atp5g3 A G 2: 73,909,307 V63A probably benign Het
Bmp6 C T 13: 38,498,952 P473S probably damaging Het
Btbd11 A T 10: 85,651,652 I995F probably damaging Het
Casp3 C A 8: 46,636,314 T199K probably damaging Het
Ccl3 C T 11: 83,649,240 C13Y possibly damaging Het
Cdc42bpa T C 1: 180,084,410 S518P probably benign Het
Clic3 A T 2: 25,458,167 I109F probably damaging Het
Dnah9 T A 11: 66,025,223 D2301V possibly damaging Het
Gm26627 A G 6: 29,507,851 probably benign Het
Gm4887 A T 7: 104,821,793 noncoding transcript Het
Hc A C 2: 35,013,531 I1037S probably damaging Het
Il2rb A G 15: 78,491,848 M1T probably null Het
Ing5 T A 1: 93,812,730 D124E probably benign Het
Jak2 A G 19: 29,271,393 E90G probably damaging Het
Kalrn A T 16: 34,016,579 I522N probably benign Het
Lipa A T 19: 34,523,432 H71Q probably benign Het
Lmnb2 C T 10: 80,906,087 V57M probably damaging Het
Mllt3 A T 4: 87,841,211 M200K probably benign Het
Mtpap G A 18: 4,396,280 S524N probably benign Het
Mup21 C G 4: 62,150,274 E52Q probably damaging Het
Nasp A G 4: 116,614,361 F90L probably benign Het
Nr1d1 T C 11: 98,770,411 D343G probably benign Het
Otop2 T A 11: 115,329,044 F237I probably damaging Het
Pax4 A G 6: 28,446,185 I103T probably damaging Het
Pde4a T A 9: 21,203,517 S430T probably damaging Het
Phf20l1 A G 15: 66,636,820 N843D possibly damaging Het
Pla2g7 T A 17: 43,594,292 M37K probably benign Het
Plcb3 T C 19: 6,957,692 I864V probably damaging Het
Rbm24 A G 13: 46,429,304 D233G probably damaging Het
Rps29 C A 12: 69,158,728 R32L probably benign Het
Serpind1 A G 16: 17,336,987 E226G probably damaging Het
Siglecg A T 7: 43,408,802 I38F probably damaging Het
Slc26a8 T A 17: 28,661,879 M308L probably benign Het
Supv3l1 A G 10: 62,430,504 V631A possibly damaging Het
Tcf12 T C 9: 71,885,263 *58W probably null Het
Tcrg-C2 T A 13: 19,307,345 probably benign Het
Usp34 T A 11: 23,343,515 V203E possibly damaging Het
Vmn2r108 A G 17: 20,471,028 L411P probably damaging Het
Zfp874a A T 13: 67,449,357 D42E probably benign Het
Other mutations in Prr16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Prr16 APN 18 51303120 missense possibly damaging 0.82
IGL00951:Prr16 APN 18 51303339 missense probably damaging 1.00
IGL01744:Prr16 APN 18 51302989 missense possibly damaging 0.73
IGL02345:Prr16 APN 18 51303229 missense probably damaging 1.00
IGL02833:Prr16 APN 18 51303092 missense probably damaging 1.00
LCD18:Prr16 UTSW 18 51200324 intron probably benign
R1195:Prr16 UTSW 18 51302683 missense probably damaging 1.00
R1195:Prr16 UTSW 18 51302683 missense probably damaging 1.00
R1195:Prr16 UTSW 18 51302683 missense probably damaging 1.00
R1572:Prr16 UTSW 18 51302970 missense probably benign 0.01
R1988:Prr16 UTSW 18 51303277 missense probably damaging 1.00
R3436:Prr16 UTSW 18 51303123 missense probably benign 0.00
R3685:Prr16 UTSW 18 51302820 missense probably damaging 0.99
R4609:Prr16 UTSW 18 51118067 missense possibly damaging 0.79
R4626:Prr16 UTSW 18 51302839 missense probably damaging 1.00
R5443:Prr16 UTSW 18 51303153 missense probably damaging 1.00
R6525:Prr16 UTSW 18 51303155 missense probably benign 0.01
Z1176:Prr16 UTSW 18 51303150 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGACCAGATTGACACCCTG -3'
(R):5'- ATCAGAGACTGCAACGGAGC -3'

Sequencing Primer
(F):5'- CCTCTGATCTACAGCTGGAAGATG -3'
(R):5'- ACGGAGCCTTGTCCAAGTTACTG -3'
Posted On2017-01-03