Incidental Mutation 'R5714:Slc35e2'
ID451038
Institutional Source Beutler Lab
Gene Symbol Slc35e2
Ensembl Gene ENSMUSG00000042202
Gene Namesolute carrier family 35, member E2
Synonyms
MMRRC Submission 043186-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5714 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location155601416-155623340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 155610026 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 10 (P10L)
Ref Sequence ENSEMBL: ENSMUSP00000113189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043829] [ENSMUST00000105608] [ENSMUST00000115821] [ENSMUST00000118607]
Predicted Effect probably benign
Transcript: ENSMUST00000043829
AA Change: P10L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041449
Gene: ENSMUSG00000042202
AA Change: P10L

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 50 66 N/A INTRINSIC
Pfam:TPT 73 368 7.9e-93 PFAM
Pfam:UAA 74 371 1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105608
AA Change: P10L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101233
Gene: ENSMUSG00000042202
AA Change: P10L

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 50 66 N/A INTRINSIC
Pfam:UAA 75 375 6.9e-10 PFAM
Pfam:EamA 84 215 5.8e-8 PFAM
Pfam:TPT 224 369 3.8e-34 PFAM
Pfam:EamA 237 369 3.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115821
SMART Domains Protein: ENSMUSP00000111488
Gene: ENSMUSG00000073682

DomainStartEndE-ValueType
SCOP:d1l9ha_ 17 52 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118607
AA Change: P10L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113189
Gene: ENSMUSG00000042202
AA Change: P10L

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 50 66 N/A INTRINSIC
Pfam:UAA 75 375 6.9e-10 PFAM
Pfam:EamA 84 215 5.8e-8 PFAM
Pfam:TPT 224 369 3.8e-34 PFAM
Pfam:EamA 237 369 3.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151425
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik G A 7: 34,240,516 Q717* probably null Het
Alpk2 G T 18: 65,305,461 Q1421K possibly damaging Het
Ankub1 G A 3: 57,672,837 T133M probably benign Het
Bcar3 G A 3: 122,455,087 V112M possibly damaging Het
Cacna1s A G 1: 136,112,066 K1476R probably benign Het
Cdc42ep1 C A 15: 78,849,777 A359E possibly damaging Het
Cemip T A 7: 83,975,179 D483V probably damaging Het
Cyp4f39 G A 17: 32,481,825 R156H probably damaging Het
Dpys T A 15: 39,857,157 H69L probably damaging Het
Fbxl21 A G 13: 56,527,072 I79V probably benign Het
Fgf9 T C 14: 58,109,565 L205P probably damaging Het
Fkbp14 A G 6: 54,585,850 F144L probably damaging Het
Flnb A C 14: 7,929,073 D1934A probably damaging Het
Glul T C 1: 153,906,497 probably benign Het
Helz T A 11: 107,626,521 probably null Het
Kap A G 6: 133,851,993 Y42H probably benign Het
Kcnh8 T C 17: 52,978,122 V1040A probably benign Het
Kptn A G 7: 16,120,758 probably null Het
Lypd3 A G 7: 24,639,069 T182A possibly damaging Het
Mcm5 A C 8: 75,120,910 D445A probably damaging Het
Mios T A 6: 8,215,434 I210K probably damaging Het
Nat8f2 A G 6: 85,867,909 V157A probably benign Het
Olfr1 T A 11: 73,395,361 probably null Het
Pard3b C A 1: 62,637,916 A1140E probably null Het
Pcnt A T 10: 76,420,491 D638E probably damaging Het
Pdgfra T C 5: 75,186,012 I834T probably damaging Het
Phyhd1 T A 2: 30,279,982 L162H probably damaging Het
Polg C A 7: 79,451,991 A1026S possibly damaging Het
Prl7c1 A T 13: 27,778,966 L18* probably null Het
Rars2 T A 4: 34,645,779 M232K probably benign Het
Rtl1 A G 12: 109,593,680 V575A probably damaging Het
Slc18b1 A T 10: 23,798,766 T40S probably benign Het
Slc22a19 T C 19: 7,711,022 T58A probably damaging Het
Slc27a6 A T 18: 58,598,553 E325V probably damaging Het
Srd5a3 T A 5: 76,153,566 F214Y probably benign Het
Tgfbr2 A T 9: 116,175,024 L5Q probably damaging Het
Tmem94 C A 11: 115,793,190 Q779K probably benign Het
Ttn G A 2: 76,822,493 P216S probably benign Het
Ush2a A T 1: 188,400,257 Q892L probably benign Het
Vgll4 A T 6: 114,890,776 M38K possibly damaging Het
Vmn2r109 A G 17: 20,552,859 I500T probably damaging Het
Vps33a T C 5: 123,569,500 I135V probably benign Het
Wscd1 T C 11: 71,784,435 probably null Het
Zfp457 C A 13: 67,296,426 M4I possibly damaging Het
Zfp532 G A 18: 65,623,535 G180R possibly damaging Het
Zfp97 A G 17: 17,145,609 T457A possibly damaging Het
Other mutations in Slc35e2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01919:Slc35e2 APN 4 155612730 missense probably benign
IGL02244:Slc35e2 APN 4 155618562 missense probably damaging 0.97
R1774:Slc35e2 UTSW 4 155610164 missense possibly damaging 0.51
R1856:Slc35e2 UTSW 4 155611729 missense probably damaging 1.00
R4600:Slc35e2 UTSW 4 155617649 missense probably benign 0.04
R4601:Slc35e2 UTSW 4 155617649 missense probably benign 0.04
R4603:Slc35e2 UTSW 4 155617649 missense probably benign 0.04
R4610:Slc35e2 UTSW 4 155617649 missense probably benign 0.04
R4917:Slc35e2 UTSW 4 155616236 missense probably damaging 1.00
R4918:Slc35e2 UTSW 4 155616236 missense probably damaging 1.00
R5440:Slc35e2 UTSW 4 155610026 missense probably benign
R5468:Slc35e2 UTSW 4 155610026 missense probably benign
R5469:Slc35e2 UTSW 4 155610026 missense probably benign
R5470:Slc35e2 UTSW 4 155610026 missense probably benign
R5512:Slc35e2 UTSW 4 155610026 missense probably benign
R5513:Slc35e2 UTSW 4 155610026 missense probably benign
R5514:Slc35e2 UTSW 4 155610026 missense probably benign
R5689:Slc35e2 UTSW 4 155610026 missense probably benign
R5692:Slc35e2 UTSW 4 155610026 missense probably benign
R5711:Slc35e2 UTSW 4 155610026 missense probably benign
R5799:Slc35e2 UTSW 4 155610026 missense probably benign
R5872:Slc35e2 UTSW 4 155612680 missense probably damaging 1.00
R5925:Slc35e2 UTSW 4 155611627 missense probably damaging 1.00
R5947:Slc35e2 UTSW 4 155611714 missense possibly damaging 0.70
R6044:Slc35e2 UTSW 4 155610026 missense probably benign
R6063:Slc35e2 UTSW 4 155610026 missense probably benign
R6065:Slc35e2 UTSW 4 155610026 missense probably benign
R6066:Slc35e2 UTSW 4 155610026 missense probably benign
R6188:Slc35e2 UTSW 4 155610026 missense probably benign
R6243:Slc35e2 UTSW 4 155610026 missense probably benign
R6273:Slc35e2 UTSW 4 155610026 missense probably benign
R6484:Slc35e2 UTSW 4 155612647 missense probably damaging 0.99
R6867:Slc35e2 UTSW 4 155618700 missense probably benign 0.00
R7143:Slc35e2 UTSW 4 155618594 missense probably benign 0.01
R7384:Slc35e2 UTSW 4 155610632 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCTCCACATATGTCTGCAC -3'
(R):5'- CCGACTCAATGACAGTGGTC -3'

Sequencing Primer
(F):5'- CAGGTGTCAAATGCATCTTACACAGG -3'
(R):5'- ACTCAATGACAGTGGTCTCTGTG -3'
Posted On2017-01-03