Incidental Mutation 'R5714:Vps33a'
ID451041
Institutional Source Beutler Lab
Gene Symbol Vps33a
Ensembl Gene ENSMUSG00000029434
Gene NameVPS33A CORVET/HOPS core subunit
Synonyms3830421M04Rik, bf
MMRRC Submission 043186-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5714 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location123528659-123573038 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123569500 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 135 (I135V)
Ref Sequence ENSEMBL: ENSMUSP00000031388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031388]
Predicted Effect probably benign
Transcript: ENSMUST00000031388
AA Change: I135V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031388
Gene: ENSMUSG00000029434
AA Change: I135V

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
Pfam:Sec1 34 592 7.2e-104 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198900
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene is a member of the Sec-1 domain family, and it encodes a protein similar to the yeast class C Vps33 protein. The mammalian class C VPS proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene produce hypopigmentation, an extended bleeeding time and abnormal kidney function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik G A 7: 34,240,516 Q717* probably null Het
Alpk2 G T 18: 65,305,461 Q1421K possibly damaging Het
Ankub1 G A 3: 57,672,837 T133M probably benign Het
Bcar3 G A 3: 122,455,087 V112M possibly damaging Het
Cacna1s A G 1: 136,112,066 K1476R probably benign Het
Cdc42ep1 C A 15: 78,849,777 A359E possibly damaging Het
Cemip T A 7: 83,975,179 D483V probably damaging Het
Cyp4f39 G A 17: 32,481,825 R156H probably damaging Het
Dpys T A 15: 39,857,157 H69L probably damaging Het
Fbxl21 A G 13: 56,527,072 I79V probably benign Het
Fgf9 T C 14: 58,109,565 L205P probably damaging Het
Fkbp14 A G 6: 54,585,850 F144L probably damaging Het
Flnb A C 14: 7,929,073 D1934A probably damaging Het
Glul T C 1: 153,906,497 probably benign Het
Helz T A 11: 107,626,521 probably null Het
Kap A G 6: 133,851,993 Y42H probably benign Het
Kcnh8 T C 17: 52,978,122 V1040A probably benign Het
Kptn A G 7: 16,120,758 probably null Het
Lypd3 A G 7: 24,639,069 T182A possibly damaging Het
Mcm5 A C 8: 75,120,910 D445A probably damaging Het
Mios T A 6: 8,215,434 I210K probably damaging Het
Nat8f2 A G 6: 85,867,909 V157A probably benign Het
Olfr1 T A 11: 73,395,361 probably null Het
Pard3b C A 1: 62,637,916 A1140E probably null Het
Pcnt A T 10: 76,420,491 D638E probably damaging Het
Pdgfra T C 5: 75,186,012 I834T probably damaging Het
Phyhd1 T A 2: 30,279,982 L162H probably damaging Het
Polg C A 7: 79,451,991 A1026S possibly damaging Het
Prl7c1 A T 13: 27,778,966 L18* probably null Het
Rars2 T A 4: 34,645,779 M232K probably benign Het
Rtl1 A G 12: 109,593,680 V575A probably damaging Het
Slc18b1 A T 10: 23,798,766 T40S probably benign Het
Slc22a19 T C 19: 7,711,022 T58A probably damaging Het
Slc27a6 A T 18: 58,598,553 E325V probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Srd5a3 T A 5: 76,153,566 F214Y probably benign Het
Tgfbr2 A T 9: 116,175,024 L5Q probably damaging Het
Tmem94 C A 11: 115,793,190 Q779K probably benign Het
Ttn G A 2: 76,822,493 P216S probably benign Het
Ush2a A T 1: 188,400,257 Q892L probably benign Het
Vgll4 A T 6: 114,890,776 M38K possibly damaging Het
Vmn2r109 A G 17: 20,552,859 I500T probably damaging Het
Wscd1 T C 11: 71,784,435 probably null Het
Zfp457 C A 13: 67,296,426 M4I possibly damaging Het
Zfp532 G A 18: 65,623,535 G180R possibly damaging Het
Zfp97 A G 17: 17,145,609 T457A possibly damaging Het
Other mutations in Vps33a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01345:Vps33a APN 5 123572943 missense probably benign 0.00
IGL01459:Vps33a APN 5 123535308 missense probably benign 0.08
IGL02473:Vps33a APN 5 123569571 missense probably damaging 1.00
IGL02899:Vps33a APN 5 123531176 missense probably damaging 1.00
R0498:Vps33a UTSW 5 123570961 missense probably benign 0.40
R1134:Vps33a UTSW 5 123570912 missense probably damaging 0.97
R1928:Vps33a UTSW 5 123558621 missense probably benign 0.02
R2012:Vps33a UTSW 5 123531181 splice site probably null
R2926:Vps33a UTSW 5 123569571 missense possibly damaging 0.83
R3688:Vps33a UTSW 5 123535211 splice site probably null
R3872:Vps33a UTSW 5 123531192 missense probably benign 0.16
R4437:Vps33a UTSW 5 123531884 missense probably benign
R5153:Vps33a UTSW 5 123558628 missense probably damaging 1.00
R5396:Vps33a UTSW 5 123558630 missense probably damaging 0.98
R5686:Vps33a UTSW 5 123547001 critical splice donor site probably null
R5814:Vps33a UTSW 5 123565056 missense probably damaging 1.00
R6845:Vps33a UTSW 5 123535272 missense probably benign 0.02
R7183:Vps33a UTSW 5 123535215 missense probably null 0.83
R7359:Vps33a UTSW 5 123558633 missense probably benign 0.00
R7593:Vps33a UTSW 5 123536556 missense probably benign 0.00
R7855:Vps33a UTSW 5 123570979 missense possibly damaging 0.78
R7885:Vps33a UTSW 5 123535249 missense possibly damaging 0.70
R8025:Vps33a UTSW 5 123558675 missense possibly damaging 0.76
R8139:Vps33a UTSW 5 123533952 missense probably benign 0.04
R8275:Vps33a UTSW 5 123569459 missense probably damaging 0.99
R8434:Vps33a UTSW 5 123533881 missense possibly damaging 0.74
R8845:Vps33a UTSW 5 123571475 critical splice donor site probably null
R8879:Vps33a UTSW 5 123533899 missense probably damaging 1.00
R8880:Vps33a UTSW 5 123569443 missense probably damaging 0.98
X0026:Vps33a UTSW 5 123547097 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CGATTGGAAGCAGCAGTGTG -3'
(R):5'- GGTGTTAAGAAAAGCAACCTCTG -3'

Sequencing Primer
(F):5'- AACATGGAAGTCTTCGGTCC -3'
(R):5'- TCTGATTCTAAGCAGCACATAAGC -3'
Posted On2017-01-03