Incidental Mutation 'R5714:Mios'
ID451042
Institutional Source Beutler Lab
Gene Symbol Mios
Ensembl Gene ENSMUSG00000042447
Gene Namemeiosis regulator for oocyte development
Synonyms
MMRRC Submission 043186-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R5714 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location8209222-8236274 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8215434 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 210 (I210K)
Ref Sequence ENSEMBL: ENSMUSP00000039301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040017]
Predicted Effect probably damaging
Transcript: ENSMUST00000040017
AA Change: I210K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000039301
Gene: ENSMUSG00000042447
AA Change: I210K

DomainStartEndE-ValueType
Blast:WD40 49 91 2e-18 BLAST
WD40 101 146 2.05e1 SMART
WD40 174 212 3.55e1 SMART
WD40 214 252 2.45e2 SMART
WD40 256 297 6.42e-1 SMART
Blast:WD40 312 354 2e-13 BLAST
Pfam:zinc_ribbon_16 737 861 1.3e-26 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik G A 7: 34,240,516 Q717* probably null Het
Alpk2 G T 18: 65,305,461 Q1421K possibly damaging Het
Ankub1 G A 3: 57,672,837 T133M probably benign Het
Bcar3 G A 3: 122,455,087 V112M possibly damaging Het
Cacna1s A G 1: 136,112,066 K1476R probably benign Het
Cdc42ep1 C A 15: 78,849,777 A359E possibly damaging Het
Cemip T A 7: 83,975,179 D483V probably damaging Het
Cyp4f39 G A 17: 32,481,825 R156H probably damaging Het
Dpys T A 15: 39,857,157 H69L probably damaging Het
Fbxl21 A G 13: 56,527,072 I79V probably benign Het
Fgf9 T C 14: 58,109,565 L205P probably damaging Het
Fkbp14 A G 6: 54,585,850 F144L probably damaging Het
Flnb A C 14: 7,929,073 D1934A probably damaging Het
Glul T C 1: 153,906,497 probably benign Het
Helz T A 11: 107,626,521 probably null Het
Kap A G 6: 133,851,993 Y42H probably benign Het
Kcnh8 T C 17: 52,978,122 V1040A probably benign Het
Kptn A G 7: 16,120,758 probably null Het
Lypd3 A G 7: 24,639,069 T182A possibly damaging Het
Mcm5 A C 8: 75,120,910 D445A probably damaging Het
Nat8f2 A G 6: 85,867,909 V157A probably benign Het
Olfr1 T A 11: 73,395,361 probably null Het
Pard3b C A 1: 62,637,916 A1140E probably null Het
Pcnt A T 10: 76,420,491 D638E probably damaging Het
Pdgfra T C 5: 75,186,012 I834T probably damaging Het
Phyhd1 T A 2: 30,279,982 L162H probably damaging Het
Polg C A 7: 79,451,991 A1026S possibly damaging Het
Prl7c1 A T 13: 27,778,966 L18* probably null Het
Rars2 T A 4: 34,645,779 M232K probably benign Het
Rtl1 A G 12: 109,593,680 V575A probably damaging Het
Slc18b1 A T 10: 23,798,766 T40S probably benign Het
Slc22a19 T C 19: 7,711,022 T58A probably damaging Het
Slc27a6 A T 18: 58,598,553 E325V probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Srd5a3 T A 5: 76,153,566 F214Y probably benign Het
Tgfbr2 A T 9: 116,175,024 L5Q probably damaging Het
Tmem94 C A 11: 115,793,190 Q779K probably benign Het
Ttn G A 2: 76,822,493 P216S probably benign Het
Ush2a A T 1: 188,400,257 Q892L probably benign Het
Vgll4 A T 6: 114,890,776 M38K possibly damaging Het
Vmn2r109 A G 17: 20,552,859 I500T probably damaging Het
Vps33a T C 5: 123,569,500 I135V probably benign Het
Wscd1 T C 11: 71,784,435 probably null Het
Zfp457 C A 13: 67,296,426 M4I possibly damaging Het
Zfp532 G A 18: 65,623,535 G180R possibly damaging Het
Zfp97 A G 17: 17,145,609 T457A possibly damaging Het
Other mutations in Mios
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Mios APN 6 8234363 critical splice donor site probably null
IGL01365:Mios APN 6 8216089 nonsense probably null
IGL01548:Mios APN 6 8234252 missense possibly damaging 0.90
IGL01898:Mios APN 6 8222668 missense probably benign 0.03
IGL02110:Mios APN 6 8215565 missense probably damaging 1.00
IGL02308:Mios APN 6 8231269 missense probably benign 0.06
IGL02375:Mios APN 6 8222598 missense probably benign 0.02
IGL02452:Mios APN 6 8222492 missense probably benign 0.01
IGL02670:Mios APN 6 8235378 splice site probably benign
IGL03083:Mios APN 6 8215156 missense probably damaging 1.00
R0462:Mios UTSW 6 8215743 missense probably benign 0.11
R0591:Mios UTSW 6 8215470 missense possibly damaging 0.52
R1351:Mios UTSW 6 8228120 missense possibly damaging 0.70
R1476:Mios UTSW 6 8234237 missense probably benign 0.01
R1802:Mios UTSW 6 8216385 nonsense probably null
R1959:Mios UTSW 6 8215437 missense probably benign 0.17
R1964:Mios UTSW 6 8215798 missense probably damaging 0.99
R2272:Mios UTSW 6 8226865 missense possibly damaging 0.71
R2915:Mios UTSW 6 8214935 missense possibly damaging 0.72
R3852:Mios UTSW 6 8216453 missense probably benign 0.09
R3876:Mios UTSW 6 8233189 missense probably damaging 0.98
R3948:Mios UTSW 6 8215496 missense probably benign
R4698:Mios UTSW 6 8228113 missense possibly damaging 0.60
R4785:Mios UTSW 6 8222464 missense probably benign
R4789:Mios UTSW 6 8235429 missense probably benign 0.06
R4866:Mios UTSW 6 8214857 missense probably damaging 1.00
R4878:Mios UTSW 6 8215094 missense probably benign 0.00
R4991:Mios UTSW 6 8215847 missense probably benign 0.00
R5479:Mios UTSW 6 8215314 missense probably benign 0.00
R6030:Mios UTSW 6 8215704 missense probably benign 0.11
R6030:Mios UTSW 6 8215704 missense probably benign 0.11
R6111:Mios UTSW 6 8214836 missense probably benign 0.01
R6455:Mios UTSW 6 8231239 missense probably benign 0.03
R7381:Mios UTSW 6 8216064 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTCCTGATATTGTTCCCATGG -3'
(R):5'- AAGTAGCAAGCAGGCCTGTC -3'

Sequencing Primer
(F):5'- TTGTTCCCATGGAAAAAGTGAGAC -3'
(R):5'- GTTGGACACCATGCGACCTTTG -3'
Posted On2017-01-03