Incidental Mutation 'R5714:Fkbp14'
ID451043
Institutional Source Beutler Lab
Gene Symbol Fkbp14
Ensembl Gene ENSMUSG00000038074
Gene NameFK506 binding protein 14
SynonymsFKBP22
MMRRC Submission 043186-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.414) question?
Stock #R5714 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location54577604-54597308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54585850 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 144 (F144L)
Ref Sequence ENSEMBL: ENSMUSP00000046070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046520] [ENSMUST00000117375] [ENSMUST00000155047]
Predicted Effect probably damaging
Transcript: ENSMUST00000046520
AA Change: F144L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046070
Gene: ENSMUSG00000038074
AA Change: F144L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:FKBP_C 38 132 2e-28 PFAM
Pfam:EF-hand_7 116 207 3.7e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117375
AA Change: F50L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112526
Gene: ENSMUSG00000038074
AA Change: F50L

DomainStartEndE-ValueType
Pfam:FKBP_C 1 38 1.1e-13 PFAM
EFh 45 73 4.08e1 SMART
EFh 89 117 2.56e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123832
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143312
Predicted Effect probably benign
Transcript: ENSMUST00000155047
SMART Domains Protein: ENSMUSP00000114521
Gene: ENSMUSG00000038074

DomainStartEndE-ValueType
Pfam:FKBP_C 38 117 7.3e-25 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the FK506-binding protein family of peptidyl-prolyl cis-trans isomerases. The encoded protein is found in the lumen of the endoplasmic reticulum, where it is thought to accelerate protein folding. Defects in this gene are a cause of a type of Ehlers-Danlos syndrome (EDS). Both a protein-coding variant and noncoding variants are transcribed from this gene. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik G A 7: 34,240,516 Q717* probably null Het
Alpk2 G T 18: 65,305,461 Q1421K possibly damaging Het
Ankub1 G A 3: 57,672,837 T133M probably benign Het
Bcar3 G A 3: 122,455,087 V112M possibly damaging Het
Cacna1s A G 1: 136,112,066 K1476R probably benign Het
Cdc42ep1 C A 15: 78,849,777 A359E possibly damaging Het
Cemip T A 7: 83,975,179 D483V probably damaging Het
Cyp4f39 G A 17: 32,481,825 R156H probably damaging Het
Dpys T A 15: 39,857,157 H69L probably damaging Het
Fbxl21 A G 13: 56,527,072 I79V probably benign Het
Fgf9 T C 14: 58,109,565 L205P probably damaging Het
Flnb A C 14: 7,929,073 D1934A probably damaging Het
Glul T C 1: 153,906,497 probably benign Het
Helz T A 11: 107,626,521 probably null Het
Kap A G 6: 133,851,993 Y42H probably benign Het
Kcnh8 T C 17: 52,978,122 V1040A probably benign Het
Kptn A G 7: 16,120,758 probably null Het
Lypd3 A G 7: 24,639,069 T182A possibly damaging Het
Mcm5 A C 8: 75,120,910 D445A probably damaging Het
Mios T A 6: 8,215,434 I210K probably damaging Het
Nat8f2 A G 6: 85,867,909 V157A probably benign Het
Olfr1 T A 11: 73,395,361 probably null Het
Pard3b C A 1: 62,637,916 A1140E probably null Het
Pcnt A T 10: 76,420,491 D638E probably damaging Het
Pdgfra T C 5: 75,186,012 I834T probably damaging Het
Phyhd1 T A 2: 30,279,982 L162H probably damaging Het
Polg C A 7: 79,451,991 A1026S possibly damaging Het
Prl7c1 A T 13: 27,778,966 L18* probably null Het
Rars2 T A 4: 34,645,779 M232K probably benign Het
Rtl1 A G 12: 109,593,680 V575A probably damaging Het
Slc18b1 A T 10: 23,798,766 T40S probably benign Het
Slc22a19 T C 19: 7,711,022 T58A probably damaging Het
Slc27a6 A T 18: 58,598,553 E325V probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Srd5a3 T A 5: 76,153,566 F214Y probably benign Het
Tgfbr2 A T 9: 116,175,024 L5Q probably damaging Het
Tmem94 C A 11: 115,793,190 Q779K probably benign Het
Ttn G A 2: 76,822,493 P216S probably benign Het
Ush2a A T 1: 188,400,257 Q892L probably benign Het
Vgll4 A T 6: 114,890,776 M38K possibly damaging Het
Vmn2r109 A G 17: 20,552,859 I500T probably damaging Het
Vps33a T C 5: 123,569,500 I135V probably benign Het
Wscd1 T C 11: 71,784,435 probably null Het
Zfp457 C A 13: 67,296,426 M4I possibly damaging Het
Zfp532 G A 18: 65,623,535 G180R possibly damaging Het
Zfp97 A G 17: 17,145,609 T457A possibly damaging Het
Other mutations in Fkbp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02953:Fkbp14 APN 6 54579682 missense probably damaging 1.00
IGL03056:Fkbp14 APN 6 54579544 missense probably benign 0.00
R4178:Fkbp14 UTSW 6 54589314 missense probably damaging 1.00
R4863:Fkbp14 UTSW 6 54585945 splice site probably benign
R4975:Fkbp14 UTSW 6 54592958 missense probably benign 0.01
R5710:Fkbp14 UTSW 6 54589270 splice site probably null
R6671:Fkbp14 UTSW 6 54579677 missense probably damaging 1.00
R6792:Fkbp14 UTSW 6 54585852 nonsense probably null
R7606:Fkbp14 UTSW 6 54593018 missense probably benign 0.01
R7748:Fkbp14 UTSW 6 54595520 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGATACAAATCAGTCTCAAGGGG -3'
(R):5'- TGACCATTGTAGAGCACCTCTTC -3'

Sequencing Primer
(F):5'- TGGCCACTACTTCTGAGCATGAG -3'
(R):5'- GTAGAGCACCTCTTCATTGAATG -3'
Posted On2017-01-03