Incidental Mutation 'R5714:Kptn'
ID451047
Institutional Source Beutler Lab
Gene Symbol Kptn
Ensembl Gene ENSMUSG00000006021
Gene Namekaptin
Synonymsactin-binding protein, C030013F01Rik, 2E4, 2310042D10Rik
MMRRC Submission 043186-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5714 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location16119895-16127516 bp(+) (GRCm38)
Type of Mutationunclassified (2783 bp from exon)
DNA Base Change (assembly) A to G at 16120758 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000006181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006178] [ENSMUST00000006181]
Predicted Effect probably damaging
Transcript: ENSMUST00000006178
AA Change: Y118C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006178
Gene: ENSMUSG00000006021
AA Change: Y118C

DomainStartEndE-ValueType
low complexity region 288 300 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000006181
SMART Domains Protein: ENSMUSP00000006181
Gene: ENSMUSG00000006024

DomainStartEndE-ValueType
Pfam:SNAP 8 288 4.5e-113 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129080
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140640
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141430
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152044
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a filamentous-actin-associated protein, which is involved in actin dynamics and plays an important role in neuromorphogenesis. Mutations in this gene result in recessive mental retardation-41. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased body weight, increased susceptibility to bacterial infection and abnormal homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik G A 7: 34,240,516 Q717* probably null Het
Alpk2 G T 18: 65,305,461 Q1421K possibly damaging Het
Ankub1 G A 3: 57,672,837 T133M probably benign Het
Bcar3 G A 3: 122,455,087 V112M possibly damaging Het
Cacna1s A G 1: 136,112,066 K1476R probably benign Het
Cdc42ep1 C A 15: 78,849,777 A359E possibly damaging Het
Cemip T A 7: 83,975,179 D483V probably damaging Het
Cyp4f39 G A 17: 32,481,825 R156H probably damaging Het
Dpys T A 15: 39,857,157 H69L probably damaging Het
Fbxl21 A G 13: 56,527,072 I79V probably benign Het
Fgf9 T C 14: 58,109,565 L205P probably damaging Het
Fkbp14 A G 6: 54,585,850 F144L probably damaging Het
Flnb A C 14: 7,929,073 D1934A probably damaging Het
Glul T C 1: 153,906,497 probably benign Het
Helz T A 11: 107,626,521 probably null Het
Kap A G 6: 133,851,993 Y42H probably benign Het
Kcnh8 T C 17: 52,978,122 V1040A probably benign Het
Lypd3 A G 7: 24,639,069 T182A possibly damaging Het
Mcm5 A C 8: 75,120,910 D445A probably damaging Het
Mios T A 6: 8,215,434 I210K probably damaging Het
Nat8f2 A G 6: 85,867,909 V157A probably benign Het
Olfr1 T A 11: 73,395,361 probably null Het
Pard3b C A 1: 62,637,916 A1140E probably null Het
Pcnt A T 10: 76,420,491 D638E probably damaging Het
Pdgfra T C 5: 75,186,012 I834T probably damaging Het
Phyhd1 T A 2: 30,279,982 L162H probably damaging Het
Polg C A 7: 79,451,991 A1026S possibly damaging Het
Prl7c1 A T 13: 27,778,966 L18* probably null Het
Rars2 T A 4: 34,645,779 M232K probably benign Het
Rtl1 A G 12: 109,593,680 V575A probably damaging Het
Slc18b1 A T 10: 23,798,766 T40S probably benign Het
Slc22a19 T C 19: 7,711,022 T58A probably damaging Het
Slc27a6 A T 18: 58,598,553 E325V probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Srd5a3 T A 5: 76,153,566 F214Y probably benign Het
Tgfbr2 A T 9: 116,175,024 L5Q probably damaging Het
Tmem94 C A 11: 115,793,190 Q779K probably benign Het
Ttn G A 2: 76,822,493 P216S probably benign Het
Ush2a A T 1: 188,400,257 Q892L probably benign Het
Vgll4 A T 6: 114,890,776 M38K possibly damaging Het
Vmn2r109 A G 17: 20,552,859 I500T probably damaging Het
Vps33a T C 5: 123,569,500 I135V probably benign Het
Wscd1 T C 11: 71,784,435 probably null Het
Zfp457 C A 13: 67,296,426 M4I possibly damaging Het
Zfp532 G A 18: 65,623,535 G180R possibly damaging Het
Zfp97 A G 17: 17,145,609 T457A possibly damaging Het
Other mutations in Kptn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Kptn APN 7 16120125 missense possibly damaging 0.93
IGL01844:Kptn APN 7 16123972 missense probably benign 0.05
IGL01938:Kptn APN 7 16124789 missense probably damaging 1.00
IGL02268:Kptn APN 7 16123861 missense probably benign 0.03
IGL02382:Kptn APN 7 16124020 missense probably benign 0.00
IGL02399:Kptn APN 7 16127113 unclassified probably benign
IGL03237:Kptn APN 7 16120125 missense probably damaging 0.97
captain UTSW 7 16125784 missense probably damaging 1.00
commander UTSW 7 16125785 nonsense probably null
Mate UTSW 7 16123103 missense probably damaging 1.00
PIT4687001:Kptn UTSW 7 16125826 missense probably damaging 0.96
R0344:Kptn UTSW 7 16125741 missense probably damaging 1.00
R0726:Kptn UTSW 7 16120722 missense probably damaging 0.99
R1421:Kptn UTSW 7 16123024 splice site probably benign
R1545:Kptn UTSW 7 16123963 missense probably benign 0.12
R2357:Kptn UTSW 7 16125784 missense probably damaging 1.00
R5068:Kptn UTSW 7 16123102 missense probably damaging 1.00
R5127:Kptn UTSW 7 16125785 nonsense probably null
R5195:Kptn UTSW 7 16123103 missense probably damaging 1.00
R7121:Kptn UTSW 7 16123098 missense probably damaging 1.00
R7213:Kptn UTSW 7 16120779 missense possibly damaging 0.55
R7849:Kptn UTSW 7 16120041 missense probably damaging 1.00
R7932:Kptn UTSW 7 16120041 missense probably damaging 1.00
Z1088:Kptn UTSW 7 16123070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTATAAAGGTACCACAGCACCC -3'
(R):5'- AGGGCAAAAGCCTCTGAGTG -3'

Sequencing Primer
(F):5'- AGCACCCTCCACCTGTC -3'
(R):5'- CAAAAGCCTCTGAGTGCAAGG -3'
Posted On2017-01-03