Mutagenetix > Incidental Mutations

Incidental Mutation 'R5714:Kptn'

451047

Institutional Source

Beutler Lab

Gene Symbol

Kptn

Ensembl Gene

ENSMUSG00000006021

Gene Name

kaptin

Synonyms

actin-binding protein, C030013F01Rik, 2E4, 2310042D10Rik

MMRRC Submission

043186-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5714 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

16119895-16127516 bp(+) (GRCm38)

Type of Mutation

splice site (2783 bp from exon)

DNA Base Change (assembly)

A to G at 16120758 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000006181 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006178] [ENSMUST00000006181]

Predicted Effect

probably damaging
Transcript: ENSMUST00000006178
AA Change: Y118C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000006178
Gene: ENSMUSG00000006021
AA Change: Y118C

Domain	Start	End	E-Value	Type
low complexity region	288	300	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000006181

SMART Domains

Protein: ENSMUSP00000006181
Gene: ENSMUSG00000006024

Domain	Start	End	E-Value	Type
Pfam:SNAP	8	288	4.5e-113	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127584

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129080

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130170

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140640

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141430

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149255

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149388

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150208

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152044

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a filamentous-actin-associated protein, which is involved in actin dynamics and plays an important role in neuromorphogenesis. Mutations in this gene result in recessive mental retardation-41. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased body weight, increased susceptibility to bacterial infection and abnormal homeostasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	G	A	7: 34,240,516	Q717*	probably null	Het
Alpk2	G	T	18: 65,305,461	Q1421K	possibly damaging	Het
Ankub1	G	A	3: 57,672,837	T133M	probably benign	Het
Bcar3	G	A	3: 122,455,087	V112M	possibly damaging	Het
Cacna1s	A	G	1: 136,112,066	K1476R	probably benign	Het
Cdc42ep1	C	A	15: 78,849,777	A359E	possibly damaging	Het
Cemip	T	A	7: 83,975,179	D483V	probably damaging	Het
Cyp4f39	G	A	17: 32,481,825	R156H	probably damaging	Het
Dpys	T	A	15: 39,857,157	H69L	probably damaging	Het
Fbxl21	A	G	13: 56,527,072	I79V	probably benign	Het
Fgf9	T	C	14: 58,109,565	L205P	probably damaging	Het
Fkbp14	A	G	6: 54,585,850	F144L	probably damaging	Het
Flnb	A	C	14: 7,929,073	D1934A	probably damaging	Het
Glul	T	C	1: 153,906,497		probably benign	Het
Helz	T	A	11: 107,626,521		probably null	Het
Kap	A	G	6: 133,851,993	Y42H	probably benign	Het
Kcnh8	T	C	17: 52,978,122	V1040A	probably benign	Het
Lypd3	A	G	7: 24,639,069	T182A	possibly damaging	Het
Mcm5	A	C	8: 75,120,910	D445A	probably damaging	Het
Mios	T	A	6: 8,215,434	I210K	probably damaging	Het
Nat8f2	A	G	6: 85,867,909	V157A	probably benign	Het
Olfr1	T	A	11: 73,395,361		probably null	Het
Pard3b	C	A	1: 62,637,916	A1140E	probably null	Het
Pcnt	A	T	10: 76,420,491	D638E	probably damaging	Het
Pdgfra	T	C	5: 75,186,012	I834T	probably damaging	Het
Phyhd1	T	A	2: 30,279,982	L162H	probably damaging	Het
Polg	C	A	7: 79,451,991	A1026S	possibly damaging	Het
Prl7c1	A	T	13: 27,778,966	L18*	probably null	Het
Rars2	T	A	4: 34,645,779	M232K	probably benign	Het
Rtl1	A	G	12: 109,593,680	V575A	probably damaging	Het
Slc18b1	A	T	10: 23,798,766	T40S	probably benign	Het
Slc22a19	T	C	19: 7,711,022	T58A	probably damaging	Het
Slc27a6	A	T	18: 58,598,553	E325V	probably damaging	Het
Slc35e2	C	T	4: 155,610,026	P10L	probably benign	Het
Srd5a3	T	A	5: 76,153,566	F214Y	probably benign	Het
Tgfbr2	A	T	9: 116,175,024	L5Q	probably damaging	Het
Tmem94	C	A	11: 115,793,190	Q779K	probably benign	Het
Ttn	G	A	2: 76,822,493	P216S	probably benign	Het
Ush2a	A	T	1: 188,400,257	Q892L	probably benign	Het
Vgll4	A	T	6: 114,890,776	M38K	possibly damaging	Het
Vmn2r109	A	G	17: 20,552,859	I500T	probably damaging	Het
Vps33a	T	C	5: 123,569,500	I135V	probably benign	Het
Wscd1	T	C	11: 71,784,435		probably null	Het
Zfp457	C	A	13: 67,296,426	M4I	possibly damaging	Het
Zfp532	G	A	18: 65,623,535	G180R	possibly damaging	Het
Zfp97	A	G	17: 17,145,609	T457A	possibly damaging	Het

Other mutations in Kptn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00401:Kptn	APN	7	16120125	missense	possibly damaging	0.93
IGL01844:Kptn	APN	7	16123972	missense	probably benign	0.05
IGL01938:Kptn	APN	7	16124789	missense	probably damaging	1.00
IGL02268:Kptn	APN	7	16123861	missense	probably benign	0.03
IGL02382:Kptn	APN	7	16124020	missense	probably benign	0.00
IGL02399:Kptn	APN	7	16127113	unclassified	probably benign
IGL03237:Kptn	APN	7	16120125	missense	probably damaging	0.97
captain	UTSW	7	16125784	missense	probably damaging	1.00
commander	UTSW	7	16125785	nonsense	probably null
Mate	UTSW	7	16123103	missense	probably damaging	1.00
PIT4687001:Kptn	UTSW	7	16125826	missense	probably damaging	0.96
R0344:Kptn	UTSW	7	16125741	missense	probably damaging	1.00
R0726:Kptn	UTSW	7	16120722	missense	probably damaging	0.99
R1421:Kptn	UTSW	7	16123024	splice site	probably benign
R1545:Kptn	UTSW	7	16123963	missense	probably benign	0.12
R2357:Kptn	UTSW	7	16125784	missense	probably damaging	1.00
R5068:Kptn	UTSW	7	16123102	missense	probably damaging	1.00
R5127:Kptn	UTSW	7	16125785	nonsense	probably null
R5195:Kptn	UTSW	7	16123103	missense	probably damaging	1.00
R7121:Kptn	UTSW	7	16123098	missense	probably damaging	1.00
R7213:Kptn	UTSW	7	16120779	missense	possibly damaging	0.55
R7849:Kptn	UTSW	7	16120041	missense	probably damaging	1.00
R7978:Kptn	UTSW	7	16125772	missense	probably damaging	1.00
R8139:Kptn	UTSW	7	16123976	missense	probably benign	0.00
Z1088:Kptn	UTSW	7	16123070	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTTATAAAGGTACCACAGCACCC -3'
(R):5'- AGGGCAAAAGCCTCTGAGTG -3'

Sequencing Primer
(F):5'- AGCACCCTCCACCTGTC -3'
(R):5'- CAAAAGCCTCTGAGTGCAAGG -3'

Posted On

2017-01-03