Incidental Mutation 'R5714:Fbxl21'
ID451064
Institutional Source Beutler Lab
Gene Symbol Fbxl21
Ensembl Gene ENSMUSG00000035509
Gene NameF-box and leucine-rich repeat protein 21
SynonymsD630045D17Rik, FBL3B, FBXL3B, Psttm
MMRRC Submission 043186-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5714 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location56522472-56537898 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56527072 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 79 (I79V)
Ref Sequence ENSEMBL: ENSMUSP00000112714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045428] [ENSMUST00000121095] [ENSMUST00000121871] [ENSMUST00000124981] [ENSMUST00000128668]
Predicted Effect probably benign
Transcript: ENSMUST00000045428
AA Change: I53V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000035248
Gene: ENSMUSG00000035509
AA Change: I53V

DomainStartEndE-ValueType
FBOX 45 85 4.77e-11 SMART
SCOP:d1a4ya_ 177 398 3e-3 SMART
Blast:LRR 203 228 2e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000121095
AA Change: I79V

PolyPhen 2 Score 0.294 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112714
Gene: ENSMUSG00000035509
AA Change: I79V

DomainStartEndE-ValueType
FBOX 71 111 4.77e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121871
AA Change: I79V

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000112518
Gene: ENSMUSG00000035509
AA Change: I79V

DomainStartEndE-ValueType
FBOX 71 111 4.77e-11 SMART
SCOP:d1a4ya_ 203 424 2e-3 SMART
Blast:LRR 229 254 2e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000124981
Predicted Effect probably benign
Transcript: ENSMUST00000128668
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and, in addition to an F-box, contains 6 tandem leucine-rich repeats. The amino acid sequence of this protein is highly similar to that of f-box and leucine-rich repeat protein 3A. An allelic polymorphism in this gene results in both coding and non-coding variants; the reference genome represents the non-coding allele. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice with a point mutation exhibit a short circadian free-running period in constant darkness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik G A 7: 34,240,516 Q717* probably null Het
Alpk2 G T 18: 65,305,461 Q1421K possibly damaging Het
Ankub1 G A 3: 57,672,837 T133M probably benign Het
Bcar3 G A 3: 122,455,087 V112M possibly damaging Het
Cacna1s A G 1: 136,112,066 K1476R probably benign Het
Cdc42ep1 C A 15: 78,849,777 A359E possibly damaging Het
Cemip T A 7: 83,975,179 D483V probably damaging Het
Cyp4f39 G A 17: 32,481,825 R156H probably damaging Het
Dpys T A 15: 39,857,157 H69L probably damaging Het
Fgf9 T C 14: 58,109,565 L205P probably damaging Het
Fkbp14 A G 6: 54,585,850 F144L probably damaging Het
Flnb A C 14: 7,929,073 D1934A probably damaging Het
Glul T C 1: 153,906,497 probably benign Het
Helz T A 11: 107,626,521 probably null Het
Kap A G 6: 133,851,993 Y42H probably benign Het
Kcnh8 T C 17: 52,978,122 V1040A probably benign Het
Kptn A G 7: 16,120,758 probably null Het
Lypd3 A G 7: 24,639,069 T182A possibly damaging Het
Mcm5 A C 8: 75,120,910 D445A probably damaging Het
Mios T A 6: 8,215,434 I210K probably damaging Het
Nat8f2 A G 6: 85,867,909 V157A probably benign Het
Olfr1 T A 11: 73,395,361 probably null Het
Pard3b C A 1: 62,637,916 A1140E probably null Het
Pcnt A T 10: 76,420,491 D638E probably damaging Het
Pdgfra T C 5: 75,186,012 I834T probably damaging Het
Phyhd1 T A 2: 30,279,982 L162H probably damaging Het
Polg C A 7: 79,451,991 A1026S possibly damaging Het
Prl7c1 A T 13: 27,778,966 L18* probably null Het
Rars2 T A 4: 34,645,779 M232K probably benign Het
Rtl1 A G 12: 109,593,680 V575A probably damaging Het
Slc18b1 A T 10: 23,798,766 T40S probably benign Het
Slc22a19 T C 19: 7,711,022 T58A probably damaging Het
Slc27a6 A T 18: 58,598,553 E325V probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Srd5a3 T A 5: 76,153,566 F214Y probably benign Het
Tgfbr2 A T 9: 116,175,024 L5Q probably damaging Het
Tmem94 C A 11: 115,793,190 Q779K probably benign Het
Ttn G A 2: 76,822,493 P216S probably benign Het
Ush2a A T 1: 188,400,257 Q892L probably benign Het
Vgll4 A T 6: 114,890,776 M38K possibly damaging Het
Vmn2r109 A G 17: 20,552,859 I500T probably damaging Het
Vps33a T C 5: 123,569,500 I135V probably benign Het
Wscd1 T C 11: 71,784,435 probably null Het
Zfp457 C A 13: 67,296,426 M4I possibly damaging Het
Zfp532 G A 18: 65,623,535 G180R possibly damaging Het
Zfp97 A G 17: 17,145,609 T457A possibly damaging Het
Other mutations in Fbxl21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Fbxl21 APN 13 56527709 splice site probably benign
IGL01972:Fbxl21 APN 13 56536859 nonsense probably null
IGL02450:Fbxl21 APN 13 56526953 missense possibly damaging 0.52
IGL02667:Fbxl21 APN 13 56537129 missense probably benign 0.07
IGL02945:Fbxl21 APN 13 56527170 missense probably damaging 1.00
R1535:Fbxl21 UTSW 13 56523527 start codon destroyed probably benign 0.01
R1741:Fbxl21 UTSW 13 56537102 missense probably benign 0.06
R1863:Fbxl21 UTSW 13 56527063 missense probably benign 0.01
R1886:Fbxl21 UTSW 13 56527093 missense probably benign 0.24
R3176:Fbxl21 UTSW 13 56537122 nonsense probably null
R3276:Fbxl21 UTSW 13 56537122 nonsense probably null
R3732:Fbxl21 UTSW 13 56527017 missense probably benign 0.01
R3732:Fbxl21 UTSW 13 56527017 missense probably benign 0.01
R3733:Fbxl21 UTSW 13 56527017 missense probably benign 0.01
R4535:Fbxl21 UTSW 13 56527060 missense probably damaging 0.99
R4678:Fbxl21 UTSW 13 56537049 missense probably damaging 1.00
R5264:Fbxl21 UTSW 13 56532323 missense probably benign 0.17
R5640:Fbxl21 UTSW 13 56537381 missense probably benign 0.23
R6640:Fbxl21 UTSW 13 56537009 missense probably damaging 1.00
R6989:Fbxl21 UTSW 13 56527061 missense probably damaging 1.00
R7140:Fbxl21 UTSW 13 56532332 missense probably damaging 1.00
R7180:Fbxl21 UTSW 13 56523527 start codon destroyed probably benign 0.01
R7556:Fbxl21 UTSW 13 56526928 missense probably benign 0.35
R7760:Fbxl21 UTSW 13 56526934 missense probably benign 0.00
R7760:Fbxl21 UTSW 13 56537003 missense probably benign
R7911:Fbxl21 UTSW 13 56537163 missense probably damaging 0.99
X0019:Fbxl21 UTSW 13 56532429 missense possibly damaging 0.82
X0026:Fbxl21 UTSW 13 56527112 missense probably damaging 1.00
Z1176:Fbxl21 UTSW 13 56527003 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TCTGGTACTTACAGAATGAAGAGG -3'
(R):5'- TCAACGGAAGCTGCTCTGTAC -3'

Sequencing Primer
(F):5'- GAAGAGGAATAATTTCTCTGCCGTG -3'
(R):5'- CGGAAGCTGCTCTGTACCTTAAAG -3'
Posted On2017-01-03