Incidental Mutation 'R5714:Zfp457'
ID451065
Institutional Source Beutler Lab
Gene Symbol Zfp457
Ensembl Gene ENSMUSG00000055341
Gene Namezinc finger protein 457
SynonymsRslcan-6
MMRRC Submission 043186-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R5714 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location67288138-67306485 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 67296426 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 4 (M4I)
Ref Sequence ENSEMBL: ENSMUSP00000053879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049705] [ENSMUST00000224325]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049705
AA Change: M4I

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000053879
Gene: ENSMUSG00000055341
AA Change: M4I

DomainStartEndE-ValueType
KRAB 5 65 1.55e-29 SMART
ZnF_C2H2 81 103 2.75e-3 SMART
ZnF_C2H2 109 131 1.1e-2 SMART
ZnF_C2H2 165 187 3.63e-3 SMART
ZnF_C2H2 193 215 2.4e-3 SMART
ZnF_C2H2 221 243 1.12e-3 SMART
ZnF_C2H2 249 271 6.32e-3 SMART
ZnF_C2H2 277 299 6.32e-3 SMART
ZnF_C2H2 305 327 3.52e-1 SMART
ZnF_C2H2 333 355 3.89e-3 SMART
ZnF_C2H2 361 383 7.26e-3 SMART
ZnF_C2H2 389 411 1.2e-3 SMART
ZnF_C2H2 417 439 7.67e-2 SMART
ZnF_C2H2 445 467 1.05e1 SMART
ZnF_C2H2 473 495 3.11e-2 SMART
ZnF_C2H2 501 523 5.9e-3 SMART
ZnF_C2H2 529 551 9.08e-4 SMART
ZnF_C2H2 585 607 5.72e-1 SMART
transmembrane domain 624 646 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225090
Predicted Effect probably benign
Transcript: ENSMUST00000225338
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik G A 7: 34,240,516 Q717* probably null Het
Alpk2 G T 18: 65,305,461 Q1421K possibly damaging Het
Ankub1 G A 3: 57,672,837 T133M probably benign Het
Bcar3 G A 3: 122,455,087 V112M possibly damaging Het
Cacna1s A G 1: 136,112,066 K1476R probably benign Het
Cdc42ep1 C A 15: 78,849,777 A359E possibly damaging Het
Cemip T A 7: 83,975,179 D483V probably damaging Het
Cyp4f39 G A 17: 32,481,825 R156H probably damaging Het
Dpys T A 15: 39,857,157 H69L probably damaging Het
Fbxl21 A G 13: 56,527,072 I79V probably benign Het
Fgf9 T C 14: 58,109,565 L205P probably damaging Het
Fkbp14 A G 6: 54,585,850 F144L probably damaging Het
Flnb A C 14: 7,929,073 D1934A probably damaging Het
Glul T C 1: 153,906,497 probably benign Het
Helz T A 11: 107,626,521 probably null Het
Kap A G 6: 133,851,993 Y42H probably benign Het
Kcnh8 T C 17: 52,978,122 V1040A probably benign Het
Kptn A G 7: 16,120,758 probably null Het
Lypd3 A G 7: 24,639,069 T182A possibly damaging Het
Mcm5 A C 8: 75,120,910 D445A probably damaging Het
Mios T A 6: 8,215,434 I210K probably damaging Het
Nat8f2 A G 6: 85,867,909 V157A probably benign Het
Olfr1 T A 11: 73,395,361 probably null Het
Pard3b C A 1: 62,637,916 A1140E probably null Het
Pcnt A T 10: 76,420,491 D638E probably damaging Het
Pdgfra T C 5: 75,186,012 I834T probably damaging Het
Phyhd1 T A 2: 30,279,982 L162H probably damaging Het
Polg C A 7: 79,451,991 A1026S possibly damaging Het
Prl7c1 A T 13: 27,778,966 L18* probably null Het
Rars2 T A 4: 34,645,779 M232K probably benign Het
Rtl1 A G 12: 109,593,680 V575A probably damaging Het
Slc18b1 A T 10: 23,798,766 T40S probably benign Het
Slc22a19 T C 19: 7,711,022 T58A probably damaging Het
Slc27a6 A T 18: 58,598,553 E325V probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Srd5a3 T A 5: 76,153,566 F214Y probably benign Het
Tgfbr2 A T 9: 116,175,024 L5Q probably damaging Het
Tmem94 C A 11: 115,793,190 Q779K probably benign Het
Ttn G A 2: 76,822,493 P216S probably benign Het
Ush2a A T 1: 188,400,257 Q892L probably benign Het
Vgll4 A T 6: 114,890,776 M38K possibly damaging Het
Vmn2r109 A G 17: 20,552,859 I500T probably damaging Het
Vps33a T C 5: 123,569,500 I135V probably benign Het
Wscd1 T C 11: 71,784,435 probably null Het
Zfp532 G A 18: 65,623,535 G180R possibly damaging Het
Zfp97 A G 17: 17,145,609 T457A possibly damaging Het
Other mutations in Zfp457
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Zfp457 APN 13 67294266 missense possibly damaging 0.46
IGL02259:Zfp457 APN 13 67296407 missense possibly damaging 0.88
R0055:Zfp457 UTSW 13 67294034 missense probably damaging 0.99
R0055:Zfp457 UTSW 13 67294034 missense probably damaging 0.99
R0149:Zfp457 UTSW 13 67292646 missense probably damaging 0.97
R0211:Zfp457 UTSW 13 67293147 missense probably benign 0.01
R0211:Zfp457 UTSW 13 67293147 missense probably benign 0.01
R0230:Zfp457 UTSW 13 67294116 missense possibly damaging 0.91
R0270:Zfp457 UTSW 13 67293927 missense probably damaging 1.00
R0361:Zfp457 UTSW 13 67292646 missense probably damaging 0.97
R0561:Zfp457 UTSW 13 67294070 missense probably damaging 1.00
R0679:Zfp457 UTSW 13 67293591 missense probably damaging 1.00
R0826:Zfp457 UTSW 13 67293314 missense possibly damaging 0.85
R1136:Zfp457 UTSW 13 67293782 missense probably damaging 1.00
R1175:Zfp457 UTSW 13 67293684 missense probably damaging 1.00
R1523:Zfp457 UTSW 13 67293437 missense probably damaging 1.00
R1616:Zfp457 UTSW 13 67296311 missense possibly damaging 0.95
R2348:Zfp457 UTSW 13 67293404 missense probably benign 0.33
R4930:Zfp457 UTSW 13 67294100 missense probably damaging 1.00
R4964:Zfp457 UTSW 13 67293278 missense probably damaging 1.00
R4966:Zfp457 UTSW 13 67293278 missense probably damaging 1.00
R5040:Zfp457 UTSW 13 67292835 missense probably benign 0.03
R5129:Zfp457 UTSW 13 67293356 missense probably benign 0.00
R6017:Zfp457 UTSW 13 67293699 missense probably damaging 1.00
R6052:Zfp457 UTSW 13 67293951 missense probably damaging 1.00
R6132:Zfp457 UTSW 13 67293296 nonsense probably null
R6184:Zfp457 UTSW 13 67292912 missense possibly damaging 0.89
R6313:Zfp457 UTSW 13 67292682 missense probably damaging 1.00
R7038:Zfp457 UTSW 13 67293933 missense probably benign 0.00
R7170:Zfp457 UTSW 13 67294177 nonsense probably null
R7184:Zfp457 UTSW 13 67294001 missense possibly damaging 0.69
R7859:Zfp457 UTSW 13 67306381 start gained probably benign
R8308:Zfp457 UTSW 13 67293599 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAAAGGGAGCAACGTTCATGC -3'
(R):5'- CCTGGTCATCAAATTCCTACCTAAC -3'

Sequencing Primer
(F):5'- GCAACGTTCATGCTGACAG -3'
(R):5'- TCTCCTATAATGGACTATTGCCAG -3'
Posted On2017-01-03