Mutagenetix > Incidental Mutation

Incidental Mutation 'R5714:Flnb'

451066

Institutional Source

Beutler Lab

Gene Symbol

Flnb

Ensembl Gene

ENSMUSG00000025278

Gene Name

filamin, beta

Synonyms

MMRRC Submission

043186-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5714 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

7817957-7951588 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 7929073 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 1934 (D1934A)

Ref Sequence

ENSEMBL: ENSMUSP00000052020 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052678]

AlphaFold

Q80X90

Predicted Effect

probably damaging
Transcript: ENSMUST00000052678
AA Change: D1934A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000052020
Gene: ENSMUSG00000025278
AA Change: D1934A

Domain	Start	End	E-Value	Type
CH	18	120	2.38e-26	SMART
CH	141	237	1.83e-18	SMART
IG_FLMN	253	350	1.17e-33	SMART
IG_FLMN	353	449	2.08e-34	SMART
IG_FLMN	451	546	3.42e-35	SMART
IG_FLMN	548	639	6.06e-27	SMART
IG_FLMN	644	739	1.94e-34	SMART
IG_FLMN	741	842	4.25e-31	SMART
IG_FLMN	844	941	5.16e-30	SMART
IG_FLMN	943	1037	5.12e-25	SMART
IG_FLMN	1039	1130	5.31e-41	SMART
IG_FLMN	1132	1225	1.4e-31	SMART
IG_FLMN	1227	1325	1.42e-32	SMART
IG_FLMN	1327	1418	5.19e-35	SMART
IG_FLMN	1420	1514	2.48e-41	SMART
IG_FLMN	1516	1611	3.15e-34	SMART
IG_FLMN	1613	1707	4.99e-37	SMART
IG_FLMN	1730	1819	4.44e-11	SMART
IG_FLMN	1820	1911	5.82e-38	SMART
IG_FLMN	1914	1997	5.68e-9	SMART
IG_FLMN	2001	2092	4.45e-34	SMART
IG_FLMN	2101	2188	1.24e-9	SMART
IG_FLMN	2192	2283	4.48e-39	SMART
IG_FLMN	2286	2378	2.94e-25	SMART
IG_FLMN	2383	2474	5.66e-27	SMART
IG_FLMN	2511	2602	1.63e-27	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the filamin family. The encoded protein interacts with glycoprotein Ib alpha as part of the process to repair vascular injuries. The platelet glycoprotein Ib complex includes glycoprotein Ib alpha, and it binds the actin cytoskeleton. Mutations in this gene have been found in several conditions: atelosteogenesis type 1 and type 3; boomerang dysplasia; autosomal dominant Larsen syndrome; and spondylocarpotarsal synostosis syndrome. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mutations in this gene cause skeletal defects including runting, premature mineralization, and bone fusion. Nullizygous mice show a delay and reduction in long bone growth. Truncation mutations cause early fusion of spinal vertebrae due to enhanced chondrocyte hypertrophy and early differentiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	G	A	7: 34,240,516	Q717*	probably null	Het
Alpk2	G	T	18: 65,305,461	Q1421K	possibly damaging	Het
Ankub1	G	A	3: 57,672,837	T133M	probably benign	Het
Bcar3	G	A	3: 122,455,087	V112M	possibly damaging	Het
Cacna1s	A	G	1: 136,112,066	K1476R	probably benign	Het
Cdc42ep1	C	A	15: 78,849,777	A359E	possibly damaging	Het
Cemip	T	A	7: 83,975,179	D483V	probably damaging	Het
Cyp4f39	G	A	17: 32,481,825	R156H	probably damaging	Het
Dpys	T	A	15: 39,857,157	H69L	probably damaging	Het
Fbxl21	A	G	13: 56,527,072	I79V	probably benign	Het
Fgf9	T	C	14: 58,109,565	L205P	probably damaging	Het
Fkbp14	A	G	6: 54,585,850	F144L	probably damaging	Het
Glul	T	C	1: 153,906,497		probably benign	Het
Helz	T	A	11: 107,626,521		probably null	Het
Kap	A	G	6: 133,851,993	Y42H	probably benign	Het
Kcnh8	T	C	17: 52,978,122	V1040A	probably benign	Het
Kptn	A	G	7: 16,120,758		probably null	Het
Lypd3	A	G	7: 24,639,069	T182A	possibly damaging	Het
Mcm5	A	C	8: 75,120,910	D445A	probably damaging	Het
Mios	T	A	6: 8,215,434	I210K	probably damaging	Het
Nat8f2	A	G	6: 85,867,909	V157A	probably benign	Het
Olfr1	T	A	11: 73,395,361		probably null	Het
Pard3b	C	A	1: 62,637,916	A1140E	probably null	Het
Pcnt	A	T	10: 76,420,491	D638E	probably damaging	Het
Pdgfra	T	C	5: 75,186,012	I834T	probably damaging	Het
Phyhd1	T	A	2: 30,279,982	L162H	probably damaging	Het
Polg	C	A	7: 79,451,991	A1026S	possibly damaging	Het
Prl7c1	A	T	13: 27,778,966	L18*	probably null	Het
Rars2	T	A	4: 34,645,779	M232K	probably benign	Het
Rtl1	A	G	12: 109,593,680	V575A	probably damaging	Het
Slc18b1	A	T	10: 23,798,766	T40S	probably benign	Het
Slc22a19	T	C	19: 7,711,022	T58A	probably damaging	Het
Slc27a6	A	T	18: 58,598,553	E325V	probably damaging	Het
Slc35e2	C	T	4: 155,610,026	P10L	probably benign	Het
Srd5a3	T	A	5: 76,153,566	F214Y	probably benign	Het
Tgfbr2	A	T	9: 116,175,024	L5Q	probably damaging	Het
Tmem94	C	A	11: 115,793,190	Q779K	probably benign	Het
Ttn	G	A	2: 76,822,493	P216S	probably benign	Het
Ush2a	A	T	1: 188,400,257	Q892L	probably benign	Het
Vgll4	A	T	6: 114,890,776	M38K	possibly damaging	Het
Vmn2r109	A	G	17: 20,552,859	I500T	probably damaging	Het
Vps33a	T	C	5: 123,569,500	I135V	probably benign	Het
Wscd1	T	C	11: 71,784,435		probably null	Het
Zfp457	C	A	13: 67,296,426	M4I	possibly damaging	Het
Zfp532	G	A	18: 65,623,535	G180R	possibly damaging	Het
Zfp97	A	G	17: 17,145,609	T457A	possibly damaging	Het

Other mutations in Flnb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01017:Flnb	APN	14	7917390	splice site	probably benign
IGL01063:Flnb	APN	14	7926518	splice site	probably benign
IGL01135:Flnb	APN	14	7909736	missense	probably benign
IGL01139:Flnb	APN	14	7945989	missense	probably damaging	1.00
IGL01364:Flnb	APN	14	7934562	critical splice acceptor site	probably null
IGL01417:Flnb	APN	14	7905513	missense	probably damaging	0.99
IGL01505:Flnb	APN	14	7902003	critical splice donor site	probably null
IGL01560:Flnb	APN	14	7893829	missense	probably benign	0.07
IGL01621:Flnb	APN	14	7950470	missense	probably damaging	1.00
IGL01656:Flnb	APN	14	7902010	splice site	probably benign
IGL01889:Flnb	APN	14	7935967	missense	possibly damaging	0.85
IGL01987:Flnb	APN	14	7922748	critical splice donor site	probably null
IGL02322:Flnb	APN	14	7894676	missense	probably damaging	1.00
IGL02496:Flnb	APN	14	7930919	splice site	probably benign
IGL02752:Flnb	APN	14	7917338	missense	probably benign
IGL03001:Flnb	APN	14	7934680	missense	probably damaging	0.99
IGL03076:Flnb	APN	14	7901988	missense	probably benign	0.01
IGL03085:Flnb	APN	14	7882211	missense	probably benign
IGL03170:Flnb	APN	14	7818261	missense	possibly damaging	0.90
IGL03373:Flnb	APN	14	7890867	critical splice donor site	probably null
Boomerang	UTSW	14	7901945	missense	probably damaging	1.00
Queensland	UTSW	14	7927352	missense	probably damaging	1.00
R3437_Flnb_252	UTSW	14	7942057	missense	probably damaging	0.97
R8441_Flnb_221	UTSW	14	7896488	missense	probably benign	0.15
Rhodelinda	UTSW	14	7887682	splice site	probably benign
saul	UTSW	14	7889183	missense	probably damaging	0.99
Xerxes	UTSW	14	7867551	missense	probably damaging	1.00
R0068:Flnb	UTSW	14	7915290	missense	possibly damaging	0.49
R0068:Flnb	UTSW	14	7915290	missense	possibly damaging	0.49
R0084:Flnb	UTSW	14	7935979	missense	probably benign
R0128:Flnb	UTSW	14	7901951	missense	probably damaging	0.99
R0130:Flnb	UTSW	14	7901951	missense	probably damaging	0.99
R0148:Flnb	UTSW	14	7939077	missense	probably benign	0.01
R0166:Flnb	UTSW	14	7896115	missense	probably damaging	1.00
R0376:Flnb	UTSW	14	7946014	critical splice donor site	probably null
R0547:Flnb	UTSW	14	7912943	splice site	probably null
R0612:Flnb	UTSW	14	7887682	splice site	probably benign
R0656:Flnb	UTSW	14	7927352	missense	probably damaging	1.00
R0691:Flnb	UTSW	14	7890810	missense	probably benign	0.16
R1241:Flnb	UTSW	14	7896503	missense	probably benign	0.06
R1572:Flnb	UTSW	14	7883908	missense	probably damaging	0.97
R1682:Flnb	UTSW	14	7913121	missense	probably benign	0.04
R1807:Flnb	UTSW	14	7934645	missense	probably benign	0.26
R1848:Flnb	UTSW	14	7892113	missense	probably damaging	1.00
R1959:Flnb	UTSW	14	7884735	nonsense	probably null
R2078:Flnb	UTSW	14	7927466	missense	probably damaging	1.00
R2132:Flnb	UTSW	14	7873376	missense	probably benign	0.04
R2209:Flnb	UTSW	14	7905507	nonsense	probably null
R2212:Flnb	UTSW	14	7881652	small deletion	probably benign
R2213:Flnb	UTSW	14	7881652	small deletion	probably benign
R2363:Flnb	UTSW	14	7945950	missense	possibly damaging	0.95
R2415:Flnb	UTSW	14	7929932	missense	probably benign	0.07
R2983:Flnb	UTSW	14	7882250	missense	probably damaging	1.00
R3001:Flnb	UTSW	14	7907162	missense	probably benign	0.22
R3002:Flnb	UTSW	14	7907162	missense	probably benign	0.22
R3436:Flnb	UTSW	14	7942057	missense	probably damaging	0.97
R3437:Flnb	UTSW	14	7942057	missense	probably damaging	0.97
R3778:Flnb	UTSW	14	7915353	missense	probably benign	0.06
R3783:Flnb	UTSW	14	7889236	missense	probably benign	0.04
R4162:Flnb	UTSW	14	7915374	missense	possibly damaging	0.81
R4163:Flnb	UTSW	14	7915374	missense	possibly damaging	0.81
R4164:Flnb	UTSW	14	7915374	missense	possibly damaging	0.81
R4356:Flnb	UTSW	14	7922700	missense	probably benign
R4369:Flnb	UTSW	14	7942216	missense	probably benign
R4783:Flnb	UTSW	14	7905701	missense	probably benign	0.12
R4785:Flnb	UTSW	14	7905701	missense	probably benign	0.12
R4790:Flnb	UTSW	14	7905661	missense	probably benign	0.34
R4828:Flnb	UTSW	14	7919238	missense	probably benign	0.13
R4882:Flnb	UTSW	14	7929936	missense	possibly damaging	0.56
R5002:Flnb	UTSW	14	7945882	missense	probably damaging	1.00
R5058:Flnb	UTSW	14	7924262	nonsense	probably null
R5184:Flnb	UTSW	14	7901945	missense	probably damaging	1.00
R5186:Flnb	UTSW	14	7909748	missense	probably damaging	1.00
R5395:Flnb	UTSW	14	7883881	missense	probably benign	0.02
R5421:Flnb	UTSW	14	7926494	missense	probably damaging	1.00
R5667:Flnb	UTSW	14	7890843	missense	probably benign	0.00
R5671:Flnb	UTSW	14	7890843	missense	probably benign	0.00
R5860:Flnb	UTSW	14	7931135	missense	probably damaging	1.00
R5892:Flnb	UTSW	14	7907183	missense	probably damaging	1.00
R5924:Flnb	UTSW	14	7890765	missense	probably benign	0.00
R6131:Flnb	UTSW	14	7894635	missense	possibly damaging	0.79
R6244:Flnb	UTSW	14	7892092	missense	probably damaging	1.00
R6489:Flnb	UTSW	14	7867551	missense	probably damaging	1.00
R6582:Flnb	UTSW	14	7892275	critical splice donor site	probably null
R6586:Flnb	UTSW	14	7929138	missense	possibly damaging	0.93
R6611:Flnb	UTSW	14	7915318	missense	probably damaging	1.00
R6626:Flnb	UTSW	14	7929012	missense	probably damaging	1.00
R6700:Flnb	UTSW	14	7892189	missense	probably damaging	0.99
R6738:Flnb	UTSW	14	7904536	missense	probably benign	0.01
R6864:Flnb	UTSW	14	7905640	missense	possibly damaging	0.84
R6916:Flnb	UTSW	14	7907171	missense	probably damaging	0.99
R7117:Flnb	UTSW	14	7894214	missense	probably benign	0.02
R7164:Flnb	UTSW	14	7915944	splice site	probably null
R7328:Flnb	UTSW	14	7883788	missense	possibly damaging	0.95
R7328:Flnb	UTSW	14	7894660	nonsense	probably null
R7687:Flnb	UTSW	14	7924224	missense	probably damaging	1.00
R7716:Flnb	UTSW	14	7917274	missense	possibly damaging	0.64
R7763:Flnb	UTSW	14	7926478	missense	probably benign	0.00
R7821:Flnb	UTSW	14	7939113	missense	probably benign	0.00
R7921:Flnb	UTSW	14	7933800	missense	possibly damaging	0.57
R8008:Flnb	UTSW	14	7892155	missense	probably damaging	1.00
R8075:Flnb	UTSW	14	7913048	missense	probably benign	0.00
R8084:Flnb	UTSW	14	7907243	missense	probably benign	0.00
R8259:Flnb	UTSW	14	7889183	missense	probably damaging	0.99
R8441:Flnb	UTSW	14	7896488	missense	probably benign	0.15
R8493:Flnb	UTSW	14	7869822	missense	probably damaging	0.97
R8508:Flnb	UTSW	14	7950394	missense	probably damaging	0.98
R8531:Flnb	UTSW	14	7929939	missense	probably damaging	1.00
R8812:Flnb	UTSW	14	7887624	missense	probably benign	0.06
R8814:Flnb	UTSW	14	7927409	missense	probably damaging	1.00
R8825:Flnb	UTSW	14	7887566	missense	probably damaging	1.00
R8868:Flnb	UTSW	14	7908671	missense	probably benign	0.02
R8955:Flnb	UTSW	14	7892874	missense	probably damaging	1.00
R8955:Flnb	UTSW	14	7904688	nonsense	probably null
R8976:Flnb	UTSW	14	7901882	critical splice acceptor site	probably null
R9055:Flnb	UTSW	14	7908553	missense	probably benign	0.00
R9148:Flnb	UTSW	14	7817996	start gained	probably benign
R9179:Flnb	UTSW	14	7887541	nonsense	probably null
R9180:Flnb	UTSW	14	7818219	missense	probably damaging	1.00
R9189:Flnb	UTSW	14	7892976	missense	possibly damaging	0.90
R9286:Flnb	UTSW	14	7873414	missense	probably damaging	0.98
R9288:Flnb	UTSW	14	7904498	missense	probably benign	0.43
R9354:Flnb	UTSW	14	7818411	missense	probably benign	0.13
R9484:Flnb	UTSW	14	7929004	missense	probably benign	0.06
R9505:Flnb	UTSW	14	7904665	missense	probably benign
R9525:Flnb	UTSW	14	7905481	missense	probably damaging	1.00
R9621:Flnb	UTSW	14	7926421	missense	probably damaging	0.99
R9630:Flnb	UTSW	14	7926438	nonsense	probably null
R9739:Flnb	UTSW	14	7935954	nonsense	probably null
R9760:Flnb	UTSW	14	7929846	missense	probably damaging	0.98
X0066:Flnb	UTSW	14	7908636	missense	probably damaging	1.00
Z1088:Flnb	UTSW	14	7905871	missense	probably benign	0.04
Z1176:Flnb	UTSW	14	7942066	missense	probably benign	0.25

Predicted Primers

PCR Primer
(F):5'- GCCGTGGTCATTATATACTCATTGTC -3'
(R):5'- ACTGTAGCAACCTCCAACGG -3'

Sequencing Primer
(F):5'- CTCATTGTCAGAGGCACATGATC -3'
(R):5'- GGATCACCCACTTCCTAAGGAGTC -3'

Posted On

2017-01-03