Incidental Mutation 'R5714:Cdc42ep1'
ID 451069
Institutional Source Beutler Lab
Gene Symbol Cdc42ep1
Ensembl Gene ENSMUSG00000049521
Gene Name CDC42 effector protein (Rho GTPase binding) 1
Synonyms MSE55, 1810058K22Rik, Borg5, CEP1
MMRRC Submission 043186-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock # R5714 (G1)
Quality Score 175
Status Not validated
Chromosome 15
Chromosomal Location 78842624-78850897 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 78849777 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 359 (A359E)
Ref Sequence ENSEMBL: ENSMUSP00000060930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044584] [ENSMUST00000059619]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000044584
SMART Domains Protein: ENSMUSP00000036598
Gene: ENSMUSG00000043501

DomainStartEndE-ValueType
GLECT 5 130 1.56e-47 SMART
Gal-bind_lectin 8 129 1.44e-43 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000059619
AA Change: A359E

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000060930
Gene: ENSMUSG00000049521
AA Change: A359E

DomainStartEndE-ValueType
PBD 38 72 2.55e-6 SMART
low complexity region 89 98 N/A INTRINSIC
Pfam:BORG_CEP 115 232 2.5e-21 PFAM
low complexity region 234 266 N/A INTRINSIC
low complexity region 272 291 N/A INTRINSIC
low complexity region 330 347 N/A INTRINSIC
low complexity region 377 391 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CDC42 is a member of the Rho GTPase family that regulates multiple cellular activities, including actin polymerization. The protein encoded by this gene is a CDC42 binding protein that mediates actin cytoskeleton reorganization at the plasma membrane. This protein is secreted and is primarily found in bone marrow. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik G A 7: 34,240,516 Q717* probably null Het
Alpk2 G T 18: 65,305,461 Q1421K possibly damaging Het
Ankub1 G A 3: 57,672,837 T133M probably benign Het
Bcar3 G A 3: 122,455,087 V112M possibly damaging Het
Cacna1s A G 1: 136,112,066 K1476R probably benign Het
Cemip T A 7: 83,975,179 D483V probably damaging Het
Cyp4f39 G A 17: 32,481,825 R156H probably damaging Het
Dpys T A 15: 39,857,157 H69L probably damaging Het
Fbxl21 A G 13: 56,527,072 I79V probably benign Het
Fgf9 T C 14: 58,109,565 L205P probably damaging Het
Fkbp14 A G 6: 54,585,850 F144L probably damaging Het
Flnb A C 14: 7,929,073 D1934A probably damaging Het
Glul T C 1: 153,906,497 probably benign Het
Helz T A 11: 107,626,521 probably null Het
Kap A G 6: 133,851,993 Y42H probably benign Het
Kcnh8 T C 17: 52,978,122 V1040A probably benign Het
Kptn A G 7: 16,120,758 probably null Het
Lypd3 A G 7: 24,639,069 T182A possibly damaging Het
Mcm5 A C 8: 75,120,910 D445A probably damaging Het
Mios T A 6: 8,215,434 I210K probably damaging Het
Nat8f2 A G 6: 85,867,909 V157A probably benign Het
Olfr1 T A 11: 73,395,361 probably null Het
Pard3b C A 1: 62,637,916 A1140E probably null Het
Pcnt A T 10: 76,420,491 D638E probably damaging Het
Pdgfra T C 5: 75,186,012 I834T probably damaging Het
Phyhd1 T A 2: 30,279,982 L162H probably damaging Het
Polg C A 7: 79,451,991 A1026S possibly damaging Het
Prl7c1 A T 13: 27,778,966 L18* probably null Het
Rars2 T A 4: 34,645,779 M232K probably benign Het
Rtl1 A G 12: 109,593,680 V575A probably damaging Het
Slc18b1 A T 10: 23,798,766 T40S probably benign Het
Slc22a19 T C 19: 7,711,022 T58A probably damaging Het
Slc27a6 A T 18: 58,598,553 E325V probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Srd5a3 T A 5: 76,153,566 F214Y probably benign Het
Tgfbr2 A T 9: 116,175,024 L5Q probably damaging Het
Tmem94 C A 11: 115,793,190 Q779K probably benign Het
Ttn G A 2: 76,822,493 P216S probably benign Het
Ush2a A T 1: 188,400,257 Q892L probably benign Het
Vgll4 A T 6: 114,890,776 M38K possibly damaging Het
Vmn2r109 A G 17: 20,552,859 I500T probably damaging Het
Vps33a T C 5: 123,569,500 I135V probably benign Het
Wscd1 T C 11: 71,784,435 probably null Het
Zfp457 C A 13: 67,296,426 M4I possibly damaging Het
Zfp532 G A 18: 65,623,535 G180R possibly damaging Het
Zfp97 A G 17: 17,145,609 T457A possibly damaging Het
Other mutations in Cdc42ep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4378001:Cdc42ep1 UTSW 15 78849680 missense possibly damaging 0.83
R2111:Cdc42ep1 UTSW 15 78847492 missense probably damaging 1.00
R3689:Cdc42ep1 UTSW 15 78847429 missense probably benign 0.03
R3690:Cdc42ep1 UTSW 15 78847429 missense probably benign 0.03
R4456:Cdc42ep1 UTSW 15 78849891 missense possibly damaging 0.72
R6374:Cdc42ep1 UTSW 15 78847449 missense probably damaging 1.00
R7944:Cdc42ep1 UTSW 15 78847773 missense possibly damaging 0.94
R7945:Cdc42ep1 UTSW 15 78847773 missense possibly damaging 0.94
R7995:Cdc42ep1 UTSW 15 78847496 missense probably damaging 1.00
R8010:Cdc42ep1 UTSW 15 78847799 missense possibly damaging 0.62
R9293:Cdc42ep1 UTSW 15 78849825 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACTTCTGTGTTGGGCCCTG -3'
(R):5'- CAAATGAACTCAGCCCCTCTGTTC -3'

Sequencing Primer
(F):5'- TGCGGCTGAGGCAAAGC -3'
(R):5'- TCTGTTCTGTGAGCCCCGAG -3'
Posted On 2017-01-03