Mutagenetix > Incidental Mutation

Incidental Mutation 'R5715:Chd6'

451090

Institutional Source

Beutler Lab

Gene Symbol

Chd6

Ensembl Gene

ENSMUSG00000057133

Gene Name

chromodomain helicase DNA binding protein 6

Synonyms

6330406J24Rik, 5430439G14Rik

MMRRC Submission

043336-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.755) question?

Stock #

R5715 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

160946978-161109075 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 160949878 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 2520 (M2520V)

Ref Sequence

ENSEMBL: ENSMUSP00000042291 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039782]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000039782
AA Change: M2520V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: M2520V

Domain	Start	End	E-Value	Type
low complexity region	86	106	N/A	INTRINSIC
low complexity region	113	143	N/A	INTRINSIC
low complexity region	214	229	N/A	INTRINSIC
CHROMO	289	355	1.35e-4	SMART
CHROMO	372	430	3.48e-7	SMART
DEXDc	456	658	1.73e-39	SMART
HELICc	812	896	3.84e-23	SMART
low complexity region	1080	1094	N/A	INTRINSIC
Blast:DEXDc	1108	1153	4e-23	BLAST
SANT	1445	1504	1.51e0	SMART
low complexity region	1866	1875	N/A	INTRINSIC
low complexity region	2048	2057	N/A	INTRINSIC
low complexity region	2130	2140	N/A	INTRINSIC
low complexity region	2277	2290	N/A	INTRINSIC
low complexity region	2333	2349	N/A	INTRINSIC
low complexity region	2437	2446	N/A	INTRINSIC
low complexity region	2539	2563	N/A	INTRINSIC
low complexity region	2652	2659	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931423N10Rik	T	C	2: 23,207,977	Y56H	possibly damaging	Het
9930111J21Rik2	T	A	11: 49,019,950	Y552F	probably damaging	Het
Asprv1	T	A	6: 86,628,614	D147E	probably benign	Het
Atg4c	G	T	4: 99,258,402	L405F	probably damaging	Het
Birc6	C	T	17: 74,631,620	L2670F	probably damaging	Het
Cdc20	T	C	4: 118,434,818	D379G	probably damaging	Het
Clca4b	A	G	3: 144,913,257	V707A	probably benign	Het
Cmtm1	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	8: 104,309,470		probably benign	Het
Col12a1	A	T	9: 79,616,065	C2743*	probably null	Het
Coq6	C	A	12: 84,366,907	D70E	probably benign	Het
Cspg4	T	A	9: 56,891,051	V1450D	possibly damaging	Het
Dnah7a	A	G	1: 53,413,778	L3847P	probably damaging	Het
Drd2	T	A	9: 49,404,889	H316Q	probably benign	Het
Dusp19	T	A	2: 80,630,986	N206K	probably benign	Het
Fam13c	T	G	10: 70,534,840	F270C	probably damaging	Het
Fam20a	T	C	11: 109,678,431	E246G	probably damaging	Het
Fbxo31	A	G	8: 121,578,563	F65L	probably damaging	Het
Fshr	T	A	17: 88,986,396		probably null	Het
Fstl4	T	C	11: 53,000,416	V127A	possibly damaging	Het
Gdpd4	A	T	7: 97,961,597	I75F	probably benign	Het
Gm13128	A	G	4: 144,331,300	D159G	possibly damaging	Het
Grm5	C	A	7: 88,130,256	A968E	probably benign	Het
Gucy2g	A	C	19: 55,233,155	F305V	possibly damaging	Het
Hivep3	T	C	4: 120,096,373	F629L	probably benign	Het
Hoxb1	A	G	11: 96,366,326	E167G	probably benign	Het
Hoxd4	T	C	2: 74,727,364	L29P	probably damaging	Het
Ikbkb	A	G	8: 22,678,850	L211P	probably damaging	Het
Insc	T	C	7: 114,849,841	V499A	probably benign	Het
Irak3	A	T	10: 120,142,736	H511Q	possibly damaging	Het
Itpripl1	T	C	2: 127,142,007	E65G	probably damaging	Het
Lurap1l	T	A	4: 80,953,721	S150R	possibly damaging	Het
Mab21l3	C	T	3: 101,823,407	R172Q	probably benign	Het
Macf1	T	C	4: 123,684,014	D59G	probably damaging	Het
Mettl21a	A	T	1: 64,615,155	S68T	probably benign	Het
Mlxip	T	A	5: 123,440,058	W146R	probably damaging	Het
Mpp2	T	A	11: 102,062,261	N285I	probably damaging	Het
Mrgprb4	T	C	7: 48,199,039	N47S	probably damaging	Het
Msi2	A	G	11: 88,386,063	Y237H	probably damaging	Het
Muc4	C	T	16: 32,751,916	T598I	possibly damaging	Het
Musk	A	T	4: 58,333,663	I253F	probably damaging	Het
Myo5b	G	T	18: 74,742,175	C1550F	possibly damaging	Het
Nckap5l	T	C	15: 99,423,576	T1137A	probably benign	Het
Neb	T	C	2: 52,251,768	D3009G	probably damaging	Het
Nxph1	T	A	6: 9,247,740	V237E	probably damaging	Het
Olfr622	A	C	7: 103,639,802	S113A	probably damaging	Het
Pla2g12a	A	G	3: 129,894,942	K150E	probably damaging	Het
Ptpn23	G	A	9: 110,387,075	R1238W	probably damaging	Het
Pts	C	T	9: 50,522,278	G124R	probably damaging	Het
Rfk	A	T	19: 17,398,638	I99F	probably benign	Het
Rictor	A	T	15: 6,750,716	R151*	probably null	Het
Scn2a	T	A	2: 65,717,584	I1040N	probably benign	Het
Serinc5	A	C	13: 92,706,202	T387P	probably damaging	Het
Sh3bp5l	A	G	11: 58,346,015	Q266R	possibly damaging	Het
Slc14a2	T	C	18: 78,158,336	Y656C	probably damaging	Het
Slc26a3	T	A	12: 31,448,843		probably null	Het
Slc3a2	G	T	19: 8,708,230	H168Q	probably benign	Het
Smarca2	A	T	19: 26,649,122	I449L	probably benign	Het
Smarcc1	T	C	9: 110,196,367	V704A	possibly damaging	Het
Sox13	A	G	1: 133,386,183		probably null	Het
Sptbn5	T	C	2: 120,072,504	E7G	probably damaging	Het
Stard10	A	G	7: 101,321,903	D26G	probably damaging	Het
Tap1	A	T	17: 34,192,894	R91*	probably null	Het
Tgfbrap1	A	T	1: 43,059,937	V239D	possibly damaging	Het
Tmem209	A	T	6: 30,497,923	Y124*	probably null	Het
Tmprss2	T	A	16: 97,568,983	E327V	possibly damaging	Het
Ttbk1	T	C	17: 46,479,207	Y104C	probably damaging	Het
Ttll10	A	T	4: 156,045,391	F154I	probably damaging	Het
Ubn2	T	A	6: 38,461,477	Y40*	probably null	Het
Ubr5	A	T	15: 38,002,233	S1519T	probably benign	Het
Ugt3a1	A	C	15: 9,306,344	D193A	probably damaging	Het
Upf1	A	T	8: 70,352,978	Y6N	probably damaging	Het
Vmn2r103	A	T	17: 19,794,939	D447V	probably benign	Het
Vps39	T	C	2: 120,325,236	N519S	possibly damaging	Het
Zfp109	T	C	7: 24,229,570	E138G	possibly damaging	Het
Znrf3	A	C	11: 5,286,239	V157G	possibly damaging	Het

Other mutations in Chd6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00837:Chd6	APN	2	161042079	missense	probably benign	0.01
IGL00899:Chd6	APN	2	161029298	splice site	probably benign
IGL01104:Chd6	APN	2	160961927	missense	probably damaging	1.00
IGL01295:Chd6	APN	2	160988370	splice site	probably benign
IGL01717:Chd6	APN	2	160965259	missense	possibly damaging	0.96
IGL01795:Chd6	APN	2	160961374	missense	probably benign	0.00
IGL01814:Chd6	APN	2	161059929	missense	probably benign	0.25
IGL02016:Chd6	APN	2	160983678	missense	probably damaging	1.00
IGL02104:Chd6	APN	2	160977512	missense	probably benign
IGL02158:Chd6	APN	2	161026292	missense	possibly damaging	0.73
IGL02313:Chd6	APN	2	160965675	missense	probably damaging	1.00
IGL02472:Chd6	APN	2	160984452	splice site	probably benign
IGL02522:Chd6	APN	2	160965796	missense	probably benign	0.30
IGL02626:Chd6	APN	2	161039350	splice site	probably benign
IGL02727:Chd6	APN	2	160969463	missense	probably damaging	0.96
IGL02738:Chd6	APN	2	160965698	missense	probably benign	0.45
IGL02743:Chd6	APN	2	160960263	missense	probably damaging	1.00
IGL02800:Chd6	APN	2	160984632	missense	probably damaging	1.00
IGL02811:Chd6	APN	2	160990301	missense	probably damaging	1.00
IGL02850:Chd6	APN	2	161019616	nonsense	probably null
IGL02979:Chd6	APN	2	160966170	missense	possibly damaging	0.48
IGL02993:Chd6	APN	2	161052384	splice site	probably benign
IGL03277:Chd6	APN	2	160983061	missense	probably null	1.00
IGL03346:Chd6	APN	2	160960362	missense	probably benign	0.00
IGL03357:Chd6	APN	2	161018016	splice site	probably benign
IGL03134:Chd6	UTSW	2	160965483	missense	possibly damaging	0.88
R0106:Chd6	UTSW	2	160967902	missense	probably damaging	1.00
R0106:Chd6	UTSW	2	160967902	missense	probably damaging	1.00
R0212:Chd6	UTSW	2	161052847	missense	probably damaging	0.99
R0363:Chd6	UTSW	2	161014324	missense	probably damaging	1.00
R0399:Chd6	UTSW	2	161052688	missense	probably damaging	1.00
R0511:Chd6	UTSW	2	160992191	missense	probably damaging	0.99
R0771:Chd6	UTSW	2	161019580	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160990271	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160990271	missense	probably damaging	1.00
R1184:Chd6	UTSW	2	161030802	missense	probably damaging	1.00
R1277:Chd6	UTSW	2	160967815	missense	probably damaging	1.00
R1396:Chd6	UTSW	2	160983103	missense	probably damaging	1.00
R1647:Chd6	UTSW	2	161042058	missense	probably damaging	1.00
R1648:Chd6	UTSW	2	161042058	missense	probably damaging	1.00
R1745:Chd6	UTSW	2	160981667	missense	probably damaging	0.96
R1766:Chd6	UTSW	2	160966639	missense	probably damaging	1.00
R1871:Chd6	UTSW	2	160990256	missense	probably damaging	1.00
R1928:Chd6	UTSW	2	160968000	splice site	probably benign
R1973:Chd6	UTSW	2	160966387	missense	probably damaging	0.99
R2200:Chd6	UTSW	2	160983753	missense	probably damaging	1.00
R2340:Chd6	UTSW	2	160965759	frame shift	probably null
R2341:Chd6	UTSW	2	160965759	frame shift	probably null
R2519:Chd6	UTSW	2	161029876	missense	possibly damaging	0.66
R2919:Chd6	UTSW	2	160967880	missense	possibly damaging	0.89
R3025:Chd6	UTSW	2	160966552	small deletion	probably benign
R3426:Chd6	UTSW	2	160990255	missense	probably damaging	1.00
R3427:Chd6	UTSW	2	160990255	missense	probably damaging	1.00
R4042:Chd6	UTSW	2	160988333	missense	probably damaging	1.00
R4273:Chd6	UTSW	2	160961291	missense	probably benign	0.04
R4360:Chd6	UTSW	2	160949856	missense	possibly damaging	0.48
R4399:Chd6	UTSW	2	160965318	missense	probably benign
R4458:Chd6	UTSW	2	161029876	missense	possibly damaging	0.66
R4583:Chd6	UTSW	2	161014194	missense	probably damaging	1.00
R4625:Chd6	UTSW	2	160969492	missense	probably damaging	1.00
R4740:Chd6	UTSW	2	160970183	missense	probably benign
R4765:Chd6	UTSW	2	160966244	nonsense	probably null
R4779:Chd6	UTSW	2	160949557	missense	probably damaging	1.00
R4877:Chd6	UTSW	2	161029299	splice site	probably benign
R5068:Chd6	UTSW	2	160966369	missense	possibly damaging	0.54
R5215:Chd6	UTSW	2	160949953	missense	probably damaging	1.00
R5275:Chd6	UTSW	2	160969363	missense	probably benign
R5405:Chd6	UTSW	2	160965390	missense	probably benign
R5598:Chd6	UTSW	2	161014112	missense	probably damaging	1.00
R5693:Chd6	UTSW	2	160965265	missense	probably benign
R5697:Chd6	UTSW	2	161018051	missense	probably damaging	1.00
R5759:Chd6	UTSW	2	160983762	missense	possibly damaging	0.91
R5761:Chd6	UTSW	2	160957078	missense	probably damaging	1.00
R5761:Chd6	UTSW	2	160957079	missense	probably damaging	1.00
R5954:Chd6	UTSW	2	160965827	missense	probably benign	0.00
R6025:Chd6	UTSW	2	160965582	missense	probably benign
R6104:Chd6	UTSW	2	161014132	missense	probably damaging	1.00
R6247:Chd6	UTSW	2	160950048	missense	probably damaging	1.00
R6393:Chd6	UTSW	2	160979487	missense	probably damaging	1.00
R6452:Chd6	UTSW	2	160965498	missense	possibly damaging	0.76
R6468:Chd6	UTSW	2	161013067	missense	probably damaging	1.00
R6784:Chd6	UTSW	2	160966254	missense	probably damaging	1.00
R6803:Chd6	UTSW	2	160960359	missense	possibly damaging	0.64
R6869:Chd6	UTSW	2	160965730	missense	probably benign
R6895:Chd6	UTSW	2	160988340	missense	probably damaging	1.00
R6925:Chd6	UTSW	2	161013127	missense	probably damaging	0.98
R7061:Chd6	UTSW	2	161025965	nonsense	probably null
R7064:Chd6	UTSW	2	160950063	missense	probably damaging	1.00
R7248:Chd6	UTSW	2	160961279	nonsense	probably null
R7287:Chd6	UTSW	2	161008392	missense	probably benign	0.07
R7431:Chd6	UTSW	2	161026328	missense	possibly damaging	0.92
R7486:Chd6	UTSW	2	160950003	missense	probably damaging	1.00
R7509:Chd6	UTSW	2	161013154	missense	probably damaging	1.00
R7699:Chd6	UTSW	2	161025943	missense	probably benign	0.13
R7748:Chd6	UTSW	2	160966619	missense	probably benign	0.37
R7785:Chd6	UTSW	2	160970175	missense	possibly damaging	0.51
R8002:Chd6	UTSW	2	160990321	missense	probably damaging	1.00
R8261:Chd6	UTSW	2	160957082	missense	probably damaging	1.00
R8317:Chd6	UTSW	2	160990321	missense	probably damaging	1.00
R8388:Chd6	UTSW	2	161019651	missense	probably damaging	1.00
R8865:Chd6	UTSW	2	161021069	missense	probably benign	0.10
R8867:Chd6	UTSW	2	161021069	missense	probably benign	0.10
R8996:Chd6	UTSW	2	160981623	missense	probably damaging	1.00
R9091:Chd6	UTSW	2	161029873	nonsense	probably null
R9270:Chd6	UTSW	2	161029873	nonsense	probably null
R9310:Chd6	UTSW	2	161039261	missense	probably damaging	1.00
R9367:Chd6	UTSW	2	161029864	missense	possibly damaging	0.83
R9438:Chd6	UTSW	2	160957158	missense	probably benign	0.01
R9756:Chd6	UTSW	2	160960339	missense	probably benign
Z1088:Chd6	UTSW	2	160966488	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGCTTGTCGTCTACCAGAG -3'
(R):5'- AGCCATTGTAGCGGACTCTC -3'

Sequencing Primer
(F):5'- ACCAGAGCGTCTGTGTTTAC -3'
(R):5'- GACTCTCCTTCTGGAATGGGAC -3'

Posted On

2017-01-03