Mutagenetix > Incidental Mutation

Incidental Mutation 'R0550:Cntnap3'

45110

Institutional Source

Beutler Lab

Gene Symbol

Cntnap3

Ensembl Gene

ENSMUSG00000033063

Gene Name

contactin associated protein-like 3

Synonyms

MMRRC Submission

038742-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R0550 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64736182-64903955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 64762000 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 764 (T764A)

Ref Sequence

ENSEMBL: ENSMUSP00000089140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091554]

AlphaFold

E9PY62

Predicted Effect

possibly damaging
Transcript: ENSMUST00000091554
AA Change: T764A

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: T764A

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
FA58C	33	180	4.88e-17	SMART
LamG	207	345	1.47e-11	SMART
LamG	394	525	1.43e-23	SMART
EGF	553	587	1.33e-1	SMART
FBG	590	775	6.76e-1	SMART
LamG	815	942	1.89e-32	SMART
EGF_like	963	999	6.28e1	SMART
LamG	1040	1178	9.46e-15	SMART
transmembrane domain	1245	1267	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222618

Meta Mutation Damage Score

0.1181

Coding Region Coverage

1x: 99.6%
3x: 98.9%
10x: 97.0%
20x: 94.2%

Validation Efficiency

99% (76/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	A	T	11: 110,293,840	Y947N	probably damaging	Het
Acss3	C	A	10: 107,053,471	G163C	probably damaging	Het
Adcy10	A	G	1: 165,565,315	T1367A	probably benign	Het
Adcy2	A	T	13: 68,982,361	S136T	probably benign	Het
Ahdc1	G	A	4: 133,063,037	V530I	probably benign	Het
Aldh16a1	C	T	7: 45,146,229		probably null	Het
Ankrd36	T	C	11: 5,607,429		probably null	Het
Aqr	A	C	2: 114,132,976	N664K	probably damaging	Het
Atp6v1c1	T	C	15: 38,682,929		probably benign	Het
Atp8b2	C	T	3: 89,959,061		probably benign	Het
Bbx	T	C	16: 50,274,533		probably benign	Het
Bmper	T	A	9: 23,373,885	D243E	probably benign	Het
Casz1	GCCACCACCACCACCACCACCAC	GCCACCACCACCACCACCAC	4: 148,952,284		probably benign	Het
Catsperd	T	C	17: 56,663,427		probably null	Het
Ccdc92b	T	A	11: 74,629,945		probably null	Het
Cd2bp2	G	T	7: 127,193,824	T342K	probably damaging	Het
Clrn3	T	A	7: 135,528,425	I27F	possibly damaging	Het
Cnih3	TTGACGAG	T	1: 181,406,477		probably null	Het
Cttnbp2	T	G	6: 18,435,309	K183N	possibly damaging	Het
Cwc27	G	A	13: 104,804,949	P155L	probably damaging	Het
Dcaf10	T	C	4: 45,372,753	S389P	probably benign	Het
Ddx18	T	C	1: 121,555,375	K561E	probably benign	Het
Dkk3	A	G	7: 112,158,245	F51L	probably damaging	Het
Dnaic1	C	T	4: 41,596,274	R20*	probably null	Het
Dr1	G	A	5: 108,269,605	G6S	probably benign	Het
Dync2h1	A	T	9: 7,120,954		probably null	Het
Eif3l	A	G	15: 79,076,867	Y16C	probably damaging	Het
Epb41	A	G	4: 131,975,613	I464T	probably damaging	Het
Erc2	A	G	14: 28,271,651	K546E	possibly damaging	Het
F830045P16Rik	T	C	2: 129,463,509	D315G	probably damaging	Het
Fads6	A	G	11: 115,296,677	I64T	probably benign	Het
Fshr	T	C	17: 89,045,125	N107S	probably benign	Het
Gbp11	A	T	5: 105,343,750	N60K	probably benign	Het
Gm2a	C	T	11: 55,103,665	Q54*	probably null	Het
Hydin	A	G	8: 110,587,775	D4297G	probably benign	Het
Il6st	G	A	13: 112,475,114		probably null	Het
Inpp4b	T	A	8: 81,997,337	H499Q	probably benign	Het
Kif5c	A	G	2: 49,758,912	K956R	possibly damaging	Het
Krt74	G	A	15: 101,760,679		noncoding transcript	Het
Map3k9	A	T	12: 81,725,781	L649Q	probably damaging	Het
Mdn1	A	G	4: 32,730,479	D2871G	probably benign	Het
Mylk4	T	C	13: 32,716,666	T294A	probably benign	Het
Nbeal2	C	T	9: 110,642,158	V252I	probably benign	Het
Nectin3	A	G	16: 46,458,820	I265T	possibly damaging	Het
Olfr1065	A	T	2: 86,445,876	Y35*	probably null	Het
Olfr1109	G	T	2: 87,093,129	H89Q	probably benign	Het
Olfr1259	A	G	2: 89,943,389	I242T	probably damaging	Het
Olfr1447	A	T	19: 12,901,800		probably null	Het
Olfr181	A	G	16: 58,926,385	F62S	probably damaging	Het
Olfr554	G	A	7: 102,640,950	E235K	possibly damaging	Het
Olfr910	T	A	9: 38,539,380	C162S	probably damaging	Het
Opn1sw	A	T	6: 29,380,204	L71Q	probably damaging	Het
Pced1a	G	A	2: 130,419,633	P367S	probably benign	Het
Pkhd1	A	T	1: 20,347,223	M2568K	probably null	Het
Pla2r1	A	G	2: 60,425,350		probably null	Het
Plpp1	T	C	13: 112,834,985	I62T	probably benign	Het
Polr3g	G	A	13: 81,694,773	T41I	probably damaging	Het
Ptch2	T	C	4: 117,096,433		probably benign	Het
Sema4g	A	T	19: 44,997,665	H315L	probably benign	Het
Setd1b	G	T	5: 123,157,660	S1097I	unknown	Het
Sfxn4	A	G	19: 60,850,945		probably benign	Het
Sh3tc1	T	C	5: 35,699,784	E1237G	probably damaging	Het
Slc25a38	A	T	9: 120,123,643	N287I	probably benign	Het
Slc25a48	A	G	13: 56,448,998	T31A	probably benign	Het
Slc6a12	G	A	6: 121,356,918	V238I	probably damaging	Het
Slc8b1	A	G	5: 120,531,155		probably benign	Het
Slco4c1	A	C	1: 96,867,859	V158G	probably damaging	Het
Sptbn4	T	C	7: 27,364,378	T2208A	probably benign	Het
Srebf1	G	A	11: 60,201,676	T843I	probably benign	Het
Srl	A	G	16: 4,487,565	W101R	probably damaging	Het
St6galnac4	T	A	2: 32,594,019	C76*	probably null	Het
Tdrd3	C	A	14: 87,486,220	T290K	probably damaging	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Trpm3	A	G	19: 22,987,812	E1547G	probably damaging	Het
Ubn1	A	G	16: 5,062,620		probably null	Het
Usp10	T	A	8: 119,947,801	I456K	probably damaging	Het
Usp6nl	A	G	2: 6,400,323		probably benign	Het
Vit	T	A	17: 78,624,793	V443E	possibly damaging	Het
Whamm	G	A	7: 81,586,224	V392I	possibly damaging	Het
Zfhx4	A	G	3: 5,400,494	K1904R	probably damaging	Het
Zfp352	A	T	4: 90,224,690	T356S	probably damaging	Het

Other mutations in Cntnap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Cntnap3	APN	13	64772731	missense	probably damaging	1.00
IGL00782:Cntnap3	APN	13	64745805	splice site	probably benign
IGL00976:Cntnap3	APN	13	64794352	missense	probably damaging	1.00
IGL01319:Cntnap3	APN	13	64787837	missense	probably damaging	1.00
IGL01610:Cntnap3	APN	13	64757301	missense	probably damaging	0.98
IGL01861:Cntnap3	APN	13	64799108	missense	probably damaging	1.00
IGL02127:Cntnap3	APN	13	64799064	splice site	probably benign
IGL02133:Cntnap3	APN	13	64751673	splice site	probably benign
IGL02251:Cntnap3	APN	13	64762036	missense	probably damaging	1.00
IGL02272:Cntnap3	APN	13	64757411	missense	probably damaging	1.00
IGL02370:Cntnap3	APN	13	64751751	missense	probably benign
IGL02456:Cntnap3	APN	13	64799058	splice site	probably benign
IGL02589:Cntnap3	APN	13	64792430	missense	probably benign	0.08
IGL02695:Cntnap3	APN	13	64772132	missense	probably benign	0.01
IGL02850:Cntnap3	APN	13	64757409	missense	probably damaging	1.00
IGL03038:Cntnap3	APN	13	64741025	missense	possibly damaging	0.50
IGL03188:Cntnap3	APN	13	64781745	missense	probably damaging	0.97
IGL03327:Cntnap3	APN	13	64887768	nonsense	probably null
PIT4480001:Cntnap3	UTSW	13	64757210	missense	probably damaging	1.00
R0309:Cntnap3	UTSW	13	64757436	splice site	probably benign
R0422:Cntnap3	UTSW	13	64757285	missense	probably damaging	0.96
R0463:Cntnap3	UTSW	13	64778876	missense	probably damaging	1.00
R0491:Cntnap3	UTSW	13	64762045	missense	probably benign	0.01
R0499:Cntnap3	UTSW	13	64858678	missense	probably benign	0.33
R0613:Cntnap3	UTSW	13	64758414	missense	probably damaging	1.00
R0666:Cntnap3	UTSW	13	64757397	missense	probably damaging	1.00
R0840:Cntnap3	UTSW	13	64787910	missense	possibly damaging	0.94
R1577:Cntnap3	UTSW	13	64758290	missense	probably damaging	1.00
R1716:Cntnap3	UTSW	13	64762002	missense	probably damaging	1.00
R1732:Cntnap3	UTSW	13	64740812	critical splice donor site	probably null
R1739:Cntnap3	UTSW	13	64740592	missense	probably benign	0.17
R1905:Cntnap3	UTSW	13	64903764	missense	probably benign	0.04
R1988:Cntnap3	UTSW	13	64758390	missense	probably damaging	1.00
R2086:Cntnap3	UTSW	13	64794262	missense	possibly damaging	0.76
R3732:Cntnap3	UTSW	13	64740999	missense	possibly damaging	0.73
R3808:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R3809:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R4384:Cntnap3	UTSW	13	64748460	missense	probably damaging	1.00
R4433:Cntnap3	UTSW	13	64778853	missense	possibly damaging	0.92
R4631:Cntnap3	UTSW	13	64778883	missense	probably benign	0.04
R4645:Cntnap3	UTSW	13	64778788	critical splice donor site	probably null
R4702:Cntnap3	UTSW	13	64778862	missense	probably benign	0.17
R4876:Cntnap3	UTSW	13	64787706	missense	probably benign	0.00
R4994:Cntnap3	UTSW	13	64761984	missense	possibly damaging	0.55
R5043:Cntnap3	UTSW	13	64794348	missense	probably damaging	1.00
R5214:Cntnap3	UTSW	13	64762010	missense	probably damaging	1.00
R5403:Cntnap3	UTSW	13	64761978	missense	possibly damaging	0.90
R5571:Cntnap3	UTSW	13	64903758	missense	probably damaging	0.98
R5587:Cntnap3	UTSW	13	64746738	missense	probably damaging	1.00
R5695:Cntnap3	UTSW	13	64787955	missense	probably damaging	0.99
R5834:Cntnap3	UTSW	13	64748577	missense	probably benign	0.07
R5892:Cntnap3	UTSW	13	64799180	missense	probably damaging	1.00
R5950:Cntnap3	UTSW	13	64787769	missense	probably damaging	1.00
R6526:Cntnap3	UTSW	13	64781888	missense	possibly damaging	0.96
R6954:Cntnap3	UTSW	13	64748559	missense	probably benign	0.00
R7138:Cntnap3	UTSW	13	64781725	critical splice donor site	probably null
R7355:Cntnap3	UTSW	13	64771962	missense	probably benign
R7425:Cntnap3	UTSW	13	64758252	missense	probably damaging	1.00
R7521:Cntnap3	UTSW	13	64772001	missense	probably benign	0.22
R7719:Cntnap3	UTSW	13	64772777	nonsense	probably null
R7810:Cntnap3	UTSW	13	64793308	missense	possibly damaging	0.73
R7871:Cntnap3	UTSW	13	64903773	missense	probably benign	0.00
R8259:Cntnap3	UTSW	13	64787867	missense	probably damaging	0.99
R8415:Cntnap3	UTSW	13	64738665	missense	probably benign	0.31
R8491:Cntnap3	UTSW	13	64785343	missense	probably damaging	1.00
R9086:Cntnap3	UTSW	13	64781759	missense	probably damaging	1.00
R9087:Cntnap3	UTSW	13	64751718	missense	probably damaging	0.96
R9398:Cntnap3	UTSW	13	64903834	missense	probably benign	0.41
R9475:Cntnap3	UTSW	13	64799135	missense	probably damaging	1.00
R9625:Cntnap3	UTSW	13	64858765	missense	probably damaging	1.00
R9679:Cntnap3	UTSW	13	64751748	missense	probably damaging	1.00
Z1176:Cntnap3	UTSW	13	64740872	frame shift	probably null
Z1176:Cntnap3	UTSW	13	64792388	missense	probably damaging	0.98
Z1177:Cntnap3	UTSW	13	64781892	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACCCTGGCCCTAAGATTGCCTCTAC -3'
(R):5'- TACCTGGCACAGCACCTGGTCAAC -3'

Sequencing Primer
(F):5'- AAGATTGCCTCTACTTTTGTGAC -3'
(R):5'- CAGCACCTGGTCAACAGGAG -3'

Posted On

2013-06-11