Incidental Mutation 'R0550:Cntnap3'
ID45110
Institutional Source Beutler Lab
Gene Symbol Cntnap3
Ensembl Gene ENSMUSG00000033063
Gene Namecontactin associated protein-like 3
Synonyms
MMRRC Submission 038742-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R0550 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location64736182-64903955 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64762000 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 764 (T764A)
Ref Sequence ENSEMBL: ENSMUSP00000089140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091554]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091554
AA Change: T764A

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: T764A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FA58C 33 180 4.88e-17 SMART
LamG 207 345 1.47e-11 SMART
LamG 394 525 1.43e-23 SMART
EGF 553 587 1.33e-1 SMART
FBG 590 775 6.76e-1 SMART
LamG 815 942 1.89e-32 SMART
EGF_like 963 999 6.28e1 SMART
LamG 1040 1178 9.46e-15 SMART
transmembrane domain 1245 1267 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222618
Meta Mutation Damage Score 0.1181 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,293,840 Y947N probably damaging Het
Acss3 C A 10: 107,053,471 G163C probably damaging Het
Adcy10 A G 1: 165,565,315 T1367A probably benign Het
Adcy2 A T 13: 68,982,361 S136T probably benign Het
Ahdc1 G A 4: 133,063,037 V530I probably benign Het
Aldh16a1 C T 7: 45,146,229 probably null Het
Ankrd36 T C 11: 5,607,429 probably null Het
Aqr A C 2: 114,132,976 N664K probably damaging Het
Atp6v1c1 T C 15: 38,682,929 probably benign Het
Atp8b2 C T 3: 89,959,061 probably benign Het
Bbx T C 16: 50,274,533 probably benign Het
Bmper T A 9: 23,373,885 D243E probably benign Het
Casz1 GCCACCACCACCACCACCACCAC GCCACCACCACCACCACCAC 4: 148,952,284 probably benign Het
Catsperd T C 17: 56,663,427 probably null Het
Ccdc92b T A 11: 74,629,945 probably null Het
Cd2bp2 G T 7: 127,193,824 T342K probably damaging Het
Clrn3 T A 7: 135,528,425 I27F possibly damaging Het
Cnih3 TTGACGAG T 1: 181,406,477 probably null Het
Cttnbp2 T G 6: 18,435,309 K183N possibly damaging Het
Cwc27 G A 13: 104,804,949 P155L probably damaging Het
Dcaf10 T C 4: 45,372,753 S389P probably benign Het
Ddx18 T C 1: 121,555,375 K561E probably benign Het
Dkk3 A G 7: 112,158,245 F51L probably damaging Het
Dnaic1 C T 4: 41,596,274 R20* probably null Het
Dr1 G A 5: 108,269,605 G6S probably benign Het
Dync2h1 A T 9: 7,120,954 probably null Het
Eif3l A G 15: 79,076,867 Y16C probably damaging Het
Epb41 A G 4: 131,975,613 I464T probably damaging Het
Erc2 A G 14: 28,271,651 K546E possibly damaging Het
F830045P16Rik T C 2: 129,463,509 D315G probably damaging Het
Fads6 A G 11: 115,296,677 I64T probably benign Het
Fshr T C 17: 89,045,125 N107S probably benign Het
Gbp11 A T 5: 105,343,750 N60K probably benign Het
Gm2a C T 11: 55,103,665 Q54* probably null Het
Hydin A G 8: 110,587,775 D4297G probably benign Het
Il6st G A 13: 112,475,114 probably null Het
Inpp4b T A 8: 81,997,337 H499Q probably benign Het
Kif5c A G 2: 49,758,912 K956R possibly damaging Het
Krt74 G A 15: 101,760,679 noncoding transcript Het
Map3k9 A T 12: 81,725,781 L649Q probably damaging Het
Mdn1 A G 4: 32,730,479 D2871G probably benign Het
Mylk4 T C 13: 32,716,666 T294A probably benign Het
Nbeal2 C T 9: 110,642,158 V252I probably benign Het
Nectin3 A G 16: 46,458,820 I265T possibly damaging Het
Olfr1065 A T 2: 86,445,876 Y35* probably null Het
Olfr1109 G T 2: 87,093,129 H89Q probably benign Het
Olfr1259 A G 2: 89,943,389 I242T probably damaging Het
Olfr1447 A T 19: 12,901,800 probably null Het
Olfr181 A G 16: 58,926,385 F62S probably damaging Het
Olfr554 G A 7: 102,640,950 E235K possibly damaging Het
Olfr910 T A 9: 38,539,380 C162S probably damaging Het
Opn1sw A T 6: 29,380,204 L71Q probably damaging Het
Pced1a G A 2: 130,419,633 P367S probably benign Het
Pkhd1 A T 1: 20,347,223 M2568K probably null Het
Pla2r1 A G 2: 60,425,350 probably null Het
Plpp1 T C 13: 112,834,985 I62T probably benign Het
Polr3g G A 13: 81,694,773 T41I probably damaging Het
Ptch2 T C 4: 117,096,433 probably benign Het
Sema4g A T 19: 44,997,665 H315L probably benign Het
Setd1b G T 5: 123,157,660 S1097I unknown Het
Sfxn4 A G 19: 60,850,945 probably benign Het
Sh3tc1 T C 5: 35,699,784 E1237G probably damaging Het
Slc25a38 A T 9: 120,123,643 N287I probably benign Het
Slc25a48 A G 13: 56,448,998 T31A probably benign Het
Slc6a12 G A 6: 121,356,918 V238I probably damaging Het
Slc8b1 A G 5: 120,531,155 probably benign Het
Slco4c1 A C 1: 96,867,859 V158G probably damaging Het
Sptbn4 T C 7: 27,364,378 T2208A probably benign Het
Srebf1 G A 11: 60,201,676 T843I probably benign Het
Srl A G 16: 4,487,565 W101R probably damaging Het
St6galnac4 T A 2: 32,594,019 C76* probably null Het
Tdrd3 C A 14: 87,486,220 T290K probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trpm3 A G 19: 22,987,812 E1547G probably damaging Het
Ubn1 A G 16: 5,062,620 probably null Het
Usp10 T A 8: 119,947,801 I456K probably damaging Het
Usp6nl A G 2: 6,400,323 probably benign Het
Vit T A 17: 78,624,793 V443E possibly damaging Het
Whamm G A 7: 81,586,224 V392I possibly damaging Het
Zfhx4 A G 3: 5,400,494 K1904R probably damaging Het
Zfp352 A T 4: 90,224,690 T356S probably damaging Het
Other mutations in Cntnap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cntnap3 APN 13 64772731 missense probably damaging 1.00
IGL00782:Cntnap3 APN 13 64745805 splice site probably benign
IGL00976:Cntnap3 APN 13 64794352 missense probably damaging 1.00
IGL01319:Cntnap3 APN 13 64787837 missense probably damaging 1.00
IGL01610:Cntnap3 APN 13 64757301 missense probably damaging 0.98
IGL01861:Cntnap3 APN 13 64799108 missense probably damaging 1.00
IGL02127:Cntnap3 APN 13 64799064 splice site probably benign
IGL02133:Cntnap3 APN 13 64751673 splice site probably benign
IGL02251:Cntnap3 APN 13 64762036 missense probably damaging 1.00
IGL02272:Cntnap3 APN 13 64757411 missense probably damaging 1.00
IGL02370:Cntnap3 APN 13 64751751 missense probably benign
IGL02456:Cntnap3 APN 13 64799058 splice site probably benign
IGL02589:Cntnap3 APN 13 64792430 missense probably benign 0.08
IGL02695:Cntnap3 APN 13 64772132 missense probably benign 0.01
IGL02850:Cntnap3 APN 13 64757409 missense probably damaging 1.00
IGL03038:Cntnap3 APN 13 64741025 missense possibly damaging 0.50
IGL03188:Cntnap3 APN 13 64781745 missense probably damaging 0.97
IGL03327:Cntnap3 APN 13 64887768 nonsense probably null
PIT4480001:Cntnap3 UTSW 13 64757210 missense probably damaging 1.00
R0309:Cntnap3 UTSW 13 64757436 splice site probably benign
R0422:Cntnap3 UTSW 13 64757285 missense probably damaging 0.96
R0463:Cntnap3 UTSW 13 64778876 missense probably damaging 1.00
R0491:Cntnap3 UTSW 13 64762045 missense probably benign 0.01
R0499:Cntnap3 UTSW 13 64858678 missense probably benign 0.33
R0613:Cntnap3 UTSW 13 64758414 missense probably damaging 1.00
R0666:Cntnap3 UTSW 13 64757397 missense probably damaging 1.00
R0840:Cntnap3 UTSW 13 64787910 missense possibly damaging 0.94
R1577:Cntnap3 UTSW 13 64758290 missense probably damaging 1.00
R1716:Cntnap3 UTSW 13 64762002 missense probably damaging 1.00
R1732:Cntnap3 UTSW 13 64740812 critical splice donor site probably null
R1739:Cntnap3 UTSW 13 64740592 missense probably benign 0.17
R1905:Cntnap3 UTSW 13 64903764 missense probably benign 0.04
R1988:Cntnap3 UTSW 13 64758390 missense probably damaging 1.00
R2086:Cntnap3 UTSW 13 64794262 missense possibly damaging 0.76
R3732:Cntnap3 UTSW 13 64740999 missense possibly damaging 0.73
R3808:Cntnap3 UTSW 13 64781804 missense probably damaging 0.96
R3809:Cntnap3 UTSW 13 64781804 missense probably damaging 0.96
R4384:Cntnap3 UTSW 13 64748460 missense probably damaging 1.00
R4433:Cntnap3 UTSW 13 64778853 missense possibly damaging 0.92
R4631:Cntnap3 UTSW 13 64778883 missense probably benign 0.04
R4645:Cntnap3 UTSW 13 64778788 critical splice donor site probably null
R4702:Cntnap3 UTSW 13 64778862 missense probably benign 0.17
R4876:Cntnap3 UTSW 13 64787706 missense probably benign 0.00
R4994:Cntnap3 UTSW 13 64761984 missense possibly damaging 0.55
R5043:Cntnap3 UTSW 13 64794348 missense probably damaging 1.00
R5214:Cntnap3 UTSW 13 64762010 missense probably damaging 1.00
R5403:Cntnap3 UTSW 13 64761978 missense possibly damaging 0.90
R5571:Cntnap3 UTSW 13 64903758 missense probably damaging 0.98
R5587:Cntnap3 UTSW 13 64746738 missense probably damaging 1.00
R5695:Cntnap3 UTSW 13 64787955 missense probably damaging 0.99
R5834:Cntnap3 UTSW 13 64748577 missense probably benign 0.07
R5892:Cntnap3 UTSW 13 64799180 missense probably damaging 1.00
R5950:Cntnap3 UTSW 13 64787769 missense probably damaging 1.00
R6526:Cntnap3 UTSW 13 64781888 missense possibly damaging 0.96
R6954:Cntnap3 UTSW 13 64748559 missense probably benign 0.00
R7138:Cntnap3 UTSW 13 64781725 critical splice donor site probably null
R7355:Cntnap3 UTSW 13 64771962 missense probably benign
R7425:Cntnap3 UTSW 13 64758252 missense probably damaging 1.00
R7521:Cntnap3 UTSW 13 64772001 missense probably benign 0.22
R7719:Cntnap3 UTSW 13 64772777 nonsense probably null
R7810:Cntnap3 UTSW 13 64793308 missense possibly damaging 0.73
R7871:Cntnap3 UTSW 13 64903773 missense probably benign 0.00
R7954:Cntnap3 UTSW 13 64903773 missense probably benign 0.00
Z1176:Cntnap3 UTSW 13 64740872 frame shift probably null
Z1176:Cntnap3 UTSW 13 64792388 missense probably damaging 0.98
Z1177:Cntnap3 UTSW 13 64781892 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCCTGGCCCTAAGATTGCCTCTAC -3'
(R):5'- TACCTGGCACAGCACCTGGTCAAC -3'

Sequencing Primer
(F):5'- AAGATTGCCTCTACTTTTGTGAC -3'
(R):5'- CAGCACCTGGTCAACAGGAG -3'
Posted On2013-06-11