Incidental Mutation 'R0550:Cntnap3'
ID 45110
Institutional Source Beutler Lab
Gene Symbol Cntnap3
Ensembl Gene ENSMUSG00000033063
Gene Name contactin associated protein-like 3
Synonyms
MMRRC Submission 038742-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.056) question?
Stock # R0550 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 64883996-65051769 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 64909814 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 764 (T764A)
Ref Sequence ENSEMBL: ENSMUSP00000089140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091554]
AlphaFold E9PY62
Predicted Effect possibly damaging
Transcript: ENSMUST00000091554
AA Change: T764A

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: T764A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FA58C 33 180 4.88e-17 SMART
LamG 207 345 1.47e-11 SMART
LamG 394 525 1.43e-23 SMART
EGF 553 587 1.33e-1 SMART
FBG 590 775 6.76e-1 SMART
LamG 815 942 1.89e-32 SMART
EGF_like 963 999 6.28e1 SMART
LamG 1040 1178 9.46e-15 SMART
transmembrane domain 1245 1267 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222618
Meta Mutation Damage Score 0.1181 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,184,666 (GRCm39) Y947N probably damaging Het
Acss3 C A 10: 106,889,332 (GRCm39) G163C probably damaging Het
Adcy10 A G 1: 165,392,884 (GRCm39) T1367A probably benign Het
Adcy2 A T 13: 69,130,480 (GRCm39) S136T probably benign Het
Ahdc1 G A 4: 132,790,348 (GRCm39) V530I probably benign Het
Aldh16a1 C T 7: 44,795,653 (GRCm39) probably null Het
Ankrd36 T C 11: 5,557,429 (GRCm39) probably null Het
Aqr A C 2: 113,963,457 (GRCm39) N664K probably damaging Het
Atp6v1c1 T C 15: 38,683,173 (GRCm39) probably benign Het
Atp8b2 C T 3: 89,866,368 (GRCm39) probably benign Het
Bbx T C 16: 50,094,896 (GRCm39) probably benign Het
Bmper T A 9: 23,285,181 (GRCm39) D243E probably benign Het
Casz1 GCCACCACCACCACCACCACCAC GCCACCACCACCACCACCAC 4: 149,036,741 (GRCm39) probably benign Het
Catsperd T C 17: 56,970,427 (GRCm39) probably null Het
Ccdc92b T A 11: 74,520,771 (GRCm39) probably null Het
Cd2bp2 G T 7: 126,792,996 (GRCm39) T342K probably damaging Het
Clrn3 T A 7: 135,130,154 (GRCm39) I27F possibly damaging Het
Cnih3 TTGACGAG T 1: 181,234,042 (GRCm39) probably null Het
Cttnbp2 T G 6: 18,435,308 (GRCm39) K183N possibly damaging Het
Cwc27 G A 13: 104,941,457 (GRCm39) P155L probably damaging Het
Dcaf10 T C 4: 45,372,753 (GRCm39) S389P probably benign Het
Ddx18 T C 1: 121,483,104 (GRCm39) K561E probably benign Het
Dkk3 A G 7: 111,757,452 (GRCm39) F51L probably damaging Het
Dnai1 C T 4: 41,596,274 (GRCm39) R20* probably null Het
Dr1 G A 5: 108,417,471 (GRCm39) G6S probably benign Het
Dync2h1 A T 9: 7,120,954 (GRCm39) probably null Het
Eif3l A G 15: 78,961,067 (GRCm39) Y16C probably damaging Het
Epb41 A G 4: 131,702,924 (GRCm39) I464T probably damaging Het
Erc2 A G 14: 27,993,608 (GRCm39) K546E possibly damaging Het
F830045P16Rik T C 2: 129,305,429 (GRCm39) D315G probably damaging Het
Fads6 A G 11: 115,187,503 (GRCm39) I64T probably benign Het
Fshr T C 17: 89,352,553 (GRCm39) N107S probably benign Het
Gbp11 A T 5: 105,491,616 (GRCm39) N60K probably benign Het
Gm2a C T 11: 54,994,491 (GRCm39) Q54* probably null Het
Hydin A G 8: 111,314,407 (GRCm39) D4297G probably benign Het
Il6st G A 13: 112,611,648 (GRCm39) probably null Het
Inpp4b T A 8: 82,723,966 (GRCm39) H499Q probably benign Het
Kif5c A G 2: 49,648,924 (GRCm39) K956R possibly damaging Het
Krt74 G A 15: 101,669,114 (GRCm39) noncoding transcript Het
Map3k9 A T 12: 81,772,555 (GRCm39) L649Q probably damaging Het
Mdn1 A G 4: 32,730,479 (GRCm39) D2871G probably benign Het
Mylk4 T C 13: 32,900,649 (GRCm39) T294A probably benign Het
Nbeal2 C T 9: 110,471,226 (GRCm39) V252I probably benign Het
Nectin3 A G 16: 46,279,183 (GRCm39) I265T possibly damaging Het
Opn1sw A T 6: 29,380,203 (GRCm39) L71Q probably damaging Het
Or4c12 A G 2: 89,773,733 (GRCm39) I242T probably damaging Het
Or52m1 G A 7: 102,290,157 (GRCm39) E235K possibly damaging Het
Or5aq6 G T 2: 86,923,473 (GRCm39) H89Q probably benign Het
Or5b97 A T 19: 12,879,164 (GRCm39) probably null Het
Or5k17 A G 16: 58,746,748 (GRCm39) F62S probably damaging Het
Or8b46 T A 9: 38,450,676 (GRCm39) C162S probably damaging Het
Or8k27 A T 2: 86,276,220 (GRCm39) Y35* probably null Het
Pced1a G A 2: 130,261,553 (GRCm39) P367S probably benign Het
Pkhd1 A T 1: 20,417,447 (GRCm39) M2568K probably null Het
Pla2r1 A G 2: 60,255,694 (GRCm39) probably null Het
Plpp1 T C 13: 112,971,519 (GRCm39) I62T probably benign Het
Polr3g G A 13: 81,842,892 (GRCm39) T41I probably damaging Het
Ptch2 T C 4: 116,953,630 (GRCm39) probably benign Het
Sema4g A T 19: 44,986,104 (GRCm39) H315L probably benign Het
Setd1b G T 5: 123,295,723 (GRCm39) S1097I unknown Het
Sfxn4 A G 19: 60,839,383 (GRCm39) probably benign Het
Sh3tc1 T C 5: 35,857,128 (GRCm39) E1237G probably damaging Het
Slc25a38 A T 9: 119,952,709 (GRCm39) N287I probably benign Het
Slc25a48 A G 13: 56,596,811 (GRCm39) T31A probably benign Het
Slc6a12 G A 6: 121,333,877 (GRCm39) V238I probably damaging Het
Slc8b1 A G 5: 120,669,220 (GRCm39) probably benign Het
Slco4c1 A C 1: 96,795,584 (GRCm39) V158G probably damaging Het
Sptbn4 T C 7: 27,063,803 (GRCm39) T2208A probably benign Het
Srebf1 G A 11: 60,092,502 (GRCm39) T843I probably benign Het
Srl A G 16: 4,305,429 (GRCm39) W101R probably damaging Het
St6galnac4 T A 2: 32,484,031 (GRCm39) C76* probably null Het
Tdrd3 C A 14: 87,723,656 (GRCm39) T290K probably damaging Het
Tnfrsf21 C T 17: 43,349,104 (GRCm39) H239Y probably benign Het
Trpm3 A G 19: 22,965,176 (GRCm39) E1547G probably damaging Het
Ubn1 A G 16: 4,880,484 (GRCm39) probably null Het
Usp10 T A 8: 120,674,540 (GRCm39) I456K probably damaging Het
Usp6nl A G 2: 6,405,134 (GRCm39) probably benign Het
Vit T A 17: 78,932,222 (GRCm39) V443E possibly damaging Het
Whamm G A 7: 81,235,972 (GRCm39) V392I possibly damaging Het
Zfhx4 A G 3: 5,465,554 (GRCm39) K1904R probably damaging Het
Zfp352 A T 4: 90,112,927 (GRCm39) T356S probably damaging Het
Other mutations in Cntnap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cntnap3 APN 13 64,920,545 (GRCm39) missense probably damaging 1.00
IGL00782:Cntnap3 APN 13 64,893,619 (GRCm39) splice site probably benign
IGL00976:Cntnap3 APN 13 64,942,166 (GRCm39) missense probably damaging 1.00
IGL01319:Cntnap3 APN 13 64,935,651 (GRCm39) missense probably damaging 1.00
IGL01610:Cntnap3 APN 13 64,905,115 (GRCm39) missense probably damaging 0.98
IGL01861:Cntnap3 APN 13 64,946,922 (GRCm39) missense probably damaging 1.00
IGL02127:Cntnap3 APN 13 64,946,878 (GRCm39) splice site probably benign
IGL02133:Cntnap3 APN 13 64,899,487 (GRCm39) splice site probably benign
IGL02251:Cntnap3 APN 13 64,909,850 (GRCm39) missense probably damaging 1.00
IGL02272:Cntnap3 APN 13 64,905,225 (GRCm39) missense probably damaging 1.00
IGL02370:Cntnap3 APN 13 64,899,565 (GRCm39) missense probably benign
IGL02456:Cntnap3 APN 13 64,946,872 (GRCm39) splice site probably benign
IGL02589:Cntnap3 APN 13 64,940,244 (GRCm39) missense probably benign 0.08
IGL02695:Cntnap3 APN 13 64,919,946 (GRCm39) missense probably benign 0.01
IGL02850:Cntnap3 APN 13 64,905,223 (GRCm39) missense probably damaging 1.00
IGL03038:Cntnap3 APN 13 64,888,839 (GRCm39) missense possibly damaging 0.50
IGL03188:Cntnap3 APN 13 64,929,559 (GRCm39) missense probably damaging 0.97
IGL03327:Cntnap3 APN 13 65,035,582 (GRCm39) nonsense probably null
PIT4480001:Cntnap3 UTSW 13 64,905,024 (GRCm39) missense probably damaging 1.00
R0309:Cntnap3 UTSW 13 64,905,250 (GRCm39) splice site probably benign
R0422:Cntnap3 UTSW 13 64,905,099 (GRCm39) missense probably damaging 0.96
R0463:Cntnap3 UTSW 13 64,926,690 (GRCm39) missense probably damaging 1.00
R0491:Cntnap3 UTSW 13 64,909,859 (GRCm39) missense probably benign 0.01
R0499:Cntnap3 UTSW 13 65,006,492 (GRCm39) missense probably benign 0.33
R0613:Cntnap3 UTSW 13 64,906,228 (GRCm39) missense probably damaging 1.00
R0666:Cntnap3 UTSW 13 64,905,211 (GRCm39) missense probably damaging 1.00
R0840:Cntnap3 UTSW 13 64,935,724 (GRCm39) missense possibly damaging 0.94
R1577:Cntnap3 UTSW 13 64,906,104 (GRCm39) missense probably damaging 1.00
R1716:Cntnap3 UTSW 13 64,909,816 (GRCm39) missense probably damaging 1.00
R1732:Cntnap3 UTSW 13 64,888,626 (GRCm39) critical splice donor site probably null
R1739:Cntnap3 UTSW 13 64,888,406 (GRCm39) missense probably benign 0.17
R1905:Cntnap3 UTSW 13 65,051,578 (GRCm39) missense probably benign 0.04
R1988:Cntnap3 UTSW 13 64,906,204 (GRCm39) missense probably damaging 1.00
R2086:Cntnap3 UTSW 13 64,942,076 (GRCm39) missense possibly damaging 0.76
R3732:Cntnap3 UTSW 13 64,888,813 (GRCm39) missense possibly damaging 0.73
R3808:Cntnap3 UTSW 13 64,929,618 (GRCm39) missense probably damaging 0.96
R3809:Cntnap3 UTSW 13 64,929,618 (GRCm39) missense probably damaging 0.96
R4384:Cntnap3 UTSW 13 64,896,274 (GRCm39) missense probably damaging 1.00
R4433:Cntnap3 UTSW 13 64,926,667 (GRCm39) missense possibly damaging 0.92
R4631:Cntnap3 UTSW 13 64,926,697 (GRCm39) missense probably benign 0.04
R4645:Cntnap3 UTSW 13 64,926,602 (GRCm39) critical splice donor site probably null
R4702:Cntnap3 UTSW 13 64,926,676 (GRCm39) missense probably benign 0.17
R4876:Cntnap3 UTSW 13 64,935,520 (GRCm39) missense probably benign 0.00
R4994:Cntnap3 UTSW 13 64,909,798 (GRCm39) missense possibly damaging 0.55
R5043:Cntnap3 UTSW 13 64,942,162 (GRCm39) missense probably damaging 1.00
R5214:Cntnap3 UTSW 13 64,909,824 (GRCm39) missense probably damaging 1.00
R5403:Cntnap3 UTSW 13 64,909,792 (GRCm39) missense possibly damaging 0.90
R5571:Cntnap3 UTSW 13 65,051,572 (GRCm39) missense probably damaging 0.98
R5587:Cntnap3 UTSW 13 64,894,552 (GRCm39) missense probably damaging 1.00
R5695:Cntnap3 UTSW 13 64,935,769 (GRCm39) missense probably damaging 0.99
R5834:Cntnap3 UTSW 13 64,896,391 (GRCm39) missense probably benign 0.07
R5892:Cntnap3 UTSW 13 64,946,994 (GRCm39) missense probably damaging 1.00
R5950:Cntnap3 UTSW 13 64,935,583 (GRCm39) missense probably damaging 1.00
R6526:Cntnap3 UTSW 13 64,929,702 (GRCm39) missense possibly damaging 0.96
R6954:Cntnap3 UTSW 13 64,896,373 (GRCm39) missense probably benign 0.00
R7138:Cntnap3 UTSW 13 64,929,539 (GRCm39) critical splice donor site probably null
R7355:Cntnap3 UTSW 13 64,919,776 (GRCm39) missense probably benign
R7425:Cntnap3 UTSW 13 64,906,066 (GRCm39) missense probably damaging 1.00
R7521:Cntnap3 UTSW 13 64,919,815 (GRCm39) missense probably benign 0.22
R7719:Cntnap3 UTSW 13 64,920,591 (GRCm39) nonsense probably null
R7810:Cntnap3 UTSW 13 64,941,122 (GRCm39) missense possibly damaging 0.73
R7871:Cntnap3 UTSW 13 65,051,587 (GRCm39) missense probably benign 0.00
R8259:Cntnap3 UTSW 13 64,935,681 (GRCm39) missense probably damaging 0.99
R8415:Cntnap3 UTSW 13 64,886,479 (GRCm39) missense probably benign 0.31
R8491:Cntnap3 UTSW 13 64,933,157 (GRCm39) missense probably damaging 1.00
R9086:Cntnap3 UTSW 13 64,929,573 (GRCm39) missense probably damaging 1.00
R9087:Cntnap3 UTSW 13 64,899,532 (GRCm39) missense probably damaging 0.96
R9398:Cntnap3 UTSW 13 65,051,648 (GRCm39) missense probably benign 0.41
R9475:Cntnap3 UTSW 13 64,946,949 (GRCm39) missense probably damaging 1.00
R9625:Cntnap3 UTSW 13 65,006,579 (GRCm39) missense probably damaging 1.00
R9679:Cntnap3 UTSW 13 64,899,562 (GRCm39) missense probably damaging 1.00
Z1176:Cntnap3 UTSW 13 64,940,202 (GRCm39) missense probably damaging 0.98
Z1176:Cntnap3 UTSW 13 64,888,686 (GRCm39) frame shift probably null
Z1177:Cntnap3 UTSW 13 64,929,706 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCCTGGCCCTAAGATTGCCTCTAC -3'
(R):5'- TACCTGGCACAGCACCTGGTCAAC -3'

Sequencing Primer
(F):5'- AAGATTGCCTCTACTTTTGTGAC -3'
(R):5'- CAGCACCTGGTCAACAGGAG -3'
Posted On 2013-06-11