Incidental Mutation 'R0550:Adcy2'
ID 45111
Institutional Source Beutler Lab
Gene Symbol Adcy2
Ensembl Gene ENSMUSG00000021536
Gene Name adenylate cyclase 2
Synonyms
MMRRC Submission 038742-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0550 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 68620043-68999541 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 68982361 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 136 (S136T)
Ref Sequence ENSEMBL: ENSMUSP00000022013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022013]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000022013
AA Change: S136T

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000022013
Gene: ENSMUSG00000021536
AA Change: S136T

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 60 74 N/A INTRINSIC
CYCc 239 447 6.62e-66 SMART
Pfam:DUF1053 499 604 2.6e-41 PFAM
transmembrane domain 631 653 N/A INTRINSIC
low complexity region 659 673 N/A INTRINSIC
transmembrane domain 684 706 N/A INTRINSIC
transmembrane domain 738 760 N/A INTRINSIC
transmembrane domain 767 789 N/A INTRINSIC
transmembrane domain 809 826 N/A INTRINSIC
CYCc 851 1065 5.49e-40 SMART
Meta Mutation Damage Score 0.0851 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of adenylate cyclases, which are membrane-associated enzymes that catalyze the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). This enzyme is insensitive to Ca(2+)/calmodulin, and is stimulated by the G protein beta and gamma subunit complex. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,293,840 Y947N probably damaging Het
Acss3 C A 10: 107,053,471 G163C probably damaging Het
Adcy10 A G 1: 165,565,315 T1367A probably benign Het
Ahdc1 G A 4: 133,063,037 V530I probably benign Het
Aldh16a1 C T 7: 45,146,229 probably null Het
Ankrd36 T C 11: 5,607,429 probably null Het
Aqr A C 2: 114,132,976 N664K probably damaging Het
Atp6v1c1 T C 15: 38,682,929 probably benign Het
Atp8b2 C T 3: 89,959,061 probably benign Het
Bbx T C 16: 50,274,533 probably benign Het
Bmper T A 9: 23,373,885 D243E probably benign Het
Casz1 GCCACCACCACCACCACCACCAC GCCACCACCACCACCACCAC 4: 148,952,284 probably benign Het
Catsperd T C 17: 56,663,427 probably null Het
Ccdc92b T A 11: 74,629,945 probably null Het
Cd2bp2 G T 7: 127,193,824 T342K probably damaging Het
Clrn3 T A 7: 135,528,425 I27F possibly damaging Het
Cnih3 TTGACGAG T 1: 181,406,477 probably null Het
Cntnap3 T C 13: 64,762,000 T764A possibly damaging Het
Cttnbp2 T G 6: 18,435,309 K183N possibly damaging Het
Cwc27 G A 13: 104,804,949 P155L probably damaging Het
Dcaf10 T C 4: 45,372,753 S389P probably benign Het
Ddx18 T C 1: 121,555,375 K561E probably benign Het
Dkk3 A G 7: 112,158,245 F51L probably damaging Het
Dnaic1 C T 4: 41,596,274 R20* probably null Het
Dr1 G A 5: 108,269,605 G6S probably benign Het
Dync2h1 A T 9: 7,120,954 probably null Het
Eif3l A G 15: 79,076,867 Y16C probably damaging Het
Epb41 A G 4: 131,975,613 I464T probably damaging Het
Erc2 A G 14: 28,271,651 K546E possibly damaging Het
F830045P16Rik T C 2: 129,463,509 D315G probably damaging Het
Fads6 A G 11: 115,296,677 I64T probably benign Het
Fshr T C 17: 89,045,125 N107S probably benign Het
Gbp11 A T 5: 105,343,750 N60K probably benign Het
Gm2a C T 11: 55,103,665 Q54* probably null Het
Hydin A G 8: 110,587,775 D4297G probably benign Het
Il6st G A 13: 112,475,114 probably null Het
Inpp4b T A 8: 81,997,337 H499Q probably benign Het
Kif5c A G 2: 49,758,912 K956R possibly damaging Het
Krt74 G A 15: 101,760,679 noncoding transcript Het
Map3k9 A T 12: 81,725,781 L649Q probably damaging Het
Mdn1 A G 4: 32,730,479 D2871G probably benign Het
Mylk4 T C 13: 32,716,666 T294A probably benign Het
Nbeal2 C T 9: 110,642,158 V252I probably benign Het
Nectin3 A G 16: 46,458,820 I265T possibly damaging Het
Olfr1065 A T 2: 86,445,876 Y35* probably null Het
Olfr1109 G T 2: 87,093,129 H89Q probably benign Het
Olfr1259 A G 2: 89,943,389 I242T probably damaging Het
Olfr1447 A T 19: 12,901,800 probably null Het
Olfr181 A G 16: 58,926,385 F62S probably damaging Het
Olfr554 G A 7: 102,640,950 E235K possibly damaging Het
Olfr910 T A 9: 38,539,380 C162S probably damaging Het
Opn1sw A T 6: 29,380,204 L71Q probably damaging Het
Pced1a G A 2: 130,419,633 P367S probably benign Het
Pkhd1 A T 1: 20,347,223 M2568K probably null Het
Pla2r1 A G 2: 60,425,350 probably null Het
Plpp1 T C 13: 112,834,985 I62T probably benign Het
Polr3g G A 13: 81,694,773 T41I probably damaging Het
Ptch2 T C 4: 117,096,433 probably benign Het
Sema4g A T 19: 44,997,665 H315L probably benign Het
Setd1b G T 5: 123,157,660 S1097I unknown Het
Sfxn4 A G 19: 60,850,945 probably benign Het
Sh3tc1 T C 5: 35,699,784 E1237G probably damaging Het
Slc25a38 A T 9: 120,123,643 N287I probably benign Het
Slc25a48 A G 13: 56,448,998 T31A probably benign Het
Slc6a12 G A 6: 121,356,918 V238I probably damaging Het
Slc8b1 A G 5: 120,531,155 probably benign Het
Slco4c1 A C 1: 96,867,859 V158G probably damaging Het
Sptbn4 T C 7: 27,364,378 T2208A probably benign Het
Srebf1 G A 11: 60,201,676 T843I probably benign Het
Srl A G 16: 4,487,565 W101R probably damaging Het
St6galnac4 T A 2: 32,594,019 C76* probably null Het
Tdrd3 C A 14: 87,486,220 T290K probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trpm3 A G 19: 22,987,812 E1547G probably damaging Het
Ubn1 A G 16: 5,062,620 probably null Het
Usp10 T A 8: 119,947,801 I456K probably damaging Het
Usp6nl A G 2: 6,400,323 probably benign Het
Vit T A 17: 78,624,793 V443E possibly damaging Het
Whamm G A 7: 81,586,224 V392I possibly damaging Het
Zfhx4 A G 3: 5,400,494 K1904R probably damaging Het
Zfp352 A T 4: 90,224,690 T356S probably damaging Het
Other mutations in Adcy2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Adcy2 APN 13 68620796 missense probably damaging 1.00
IGL01074:Adcy2 APN 13 68796654 missense possibly damaging 0.93
IGL01394:Adcy2 APN 13 68982402 missense probably damaging 1.00
IGL01820:Adcy2 APN 13 68738545 splice site probably null
IGL02048:Adcy2 APN 13 68888067 missense possibly damaging 0.46
IGL02378:Adcy2 APN 13 68730292 missense probably damaging 1.00
IGL02419:Adcy2 APN 13 68982363 missense probably benign 0.40
IGL02896:Adcy2 APN 13 68727872 missense probably damaging 1.00
IGL02953:Adcy2 APN 13 68729328 missense probably damaging 1.00
IGL03358:Adcy2 APN 13 68729277 missense probably damaging 1.00
IGL03387:Adcy2 APN 13 68730367 missense probably damaging 1.00
PIT4305001:Adcy2 UTSW 13 68678602 missense probably benign 0.00
PIT4366001:Adcy2 UTSW 13 68709990 critical splice donor site probably benign
R0044:Adcy2 UTSW 13 68727899 missense possibly damaging 0.94
R0044:Adcy2 UTSW 13 68727899 missense possibly damaging 0.94
R0083:Adcy2 UTSW 13 68651935 missense probably damaging 0.99
R0108:Adcy2 UTSW 13 68651935 missense probably damaging 0.99
R0269:Adcy2 UTSW 13 68678606 nonsense probably null
R0369:Adcy2 UTSW 13 68671900 missense probably benign 0.00
R0480:Adcy2 UTSW 13 68732112 missense probably damaging 1.00
R0551:Adcy2 UTSW 13 68796539 missense probably damaging 1.00
R0617:Adcy2 UTSW 13 68678606 nonsense probably null
R0634:Adcy2 UTSW 13 68727945 missense possibly damaging 0.48
R0715:Adcy2 UTSW 13 68888042 missense probably benign 0.08
R0723:Adcy2 UTSW 13 68999129 missense probably damaging 1.00
R1136:Adcy2 UTSW 13 68730317 missense probably damaging 1.00
R1271:Adcy2 UTSW 13 68642498 missense probably damaging 1.00
R1349:Adcy2 UTSW 13 68668533 missense probably damaging 0.98
R1372:Adcy2 UTSW 13 68668533 missense probably damaging 0.98
R1390:Adcy2 UTSW 13 68657393 missense possibly damaging 0.94
R1495:Adcy2 UTSW 13 68796535 missense probably benign 0.30
R1706:Adcy2 UTSW 13 68720746 missense probably damaging 1.00
R1839:Adcy2 UTSW 13 68689261 splice site probably null
R2004:Adcy2 UTSW 13 68796603 missense probably damaging 1.00
R2235:Adcy2 UTSW 13 68668492 missense probably damaging 0.98
R2242:Adcy2 UTSW 13 68689341 missense probably benign 0.00
R2940:Adcy2 UTSW 13 68730305 missense probably damaging 1.00
R3624:Adcy2 UTSW 13 68642531 missense probably damaging 0.99
R3689:Adcy2 UTSW 13 68630969 missense probably damaging 1.00
R4685:Adcy2 UTSW 13 68727905 missense probably benign 0.32
R4695:Adcy2 UTSW 13 68727843 missense possibly damaging 0.67
R5213:Adcy2 UTSW 13 68620823 missense possibly damaging 0.61
R5645:Adcy2 UTSW 13 68729202 splice site probably null
R5687:Adcy2 UTSW 13 68620819 nonsense probably null
R5687:Adcy2 UTSW 13 68642569 missense probably damaging 1.00
R5833:Adcy2 UTSW 13 68738603 missense probably benign
R5846:Adcy2 UTSW 13 68738588 missense probably damaging 0.99
R5894:Adcy2 UTSW 13 68625852 missense probably damaging 1.00
R6111:Adcy2 UTSW 13 68729241 missense probably damaging 0.99
R6311:Adcy2 UTSW 13 68625792 missense probably damaging 1.00
R6642:Adcy2 UTSW 13 68620826 missense probably damaging 1.00
R6644:Adcy2 UTSW 13 68668552 missense possibly damaging 0.88
R6899:Adcy2 UTSW 13 68982381 missense probably damaging 0.99
R6917:Adcy2 UTSW 13 68620757 missense possibly damaging 0.68
R6950:Adcy2 UTSW 13 68888065 missense possibly damaging 0.93
R7006:Adcy2 UTSW 13 68888020 missense probably damaging 1.00
R7186:Adcy2 UTSW 13 68668639 missense probably damaging 1.00
R7311:Adcy2 UTSW 13 68630954 missense probably damaging 1.00
R7348:Adcy2 UTSW 13 68734675 missense possibly damaging 0.79
R7440:Adcy2 UTSW 13 68796667 missense probably damaging 0.97
R7463:Adcy2 UTSW 13 68730280 missense probably damaging 1.00
R7827:Adcy2 UTSW 13 68689281 missense probably damaging 1.00
R7919:Adcy2 UTSW 13 68887972 missense probably benign 0.08
R8144:Adcy2 UTSW 13 68734635 nonsense probably null
R8256:Adcy2 UTSW 13 68620761 missense probably damaging 1.00
R8556:Adcy2 UTSW 13 68630975 missense possibly damaging 0.61
R9121:Adcy2 UTSW 13 68671959 missense probably benign 0.35
R9128:Adcy2 UTSW 13 68625808 missense probably damaging 1.00
R9255:Adcy2 UTSW 13 68888080 missense possibly damaging 0.93
R9464:Adcy2 UTSW 13 68734657 missense probably damaging 1.00
R9749:Adcy2 UTSW 13 68625855 missense probably damaging 1.00
R9799:Adcy2 UTSW 13 68620842 missense probably benign 0.03
R9799:Adcy2 UTSW 13 68657370 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAATGACTTTCTTCTTTGTGCCTGGA -3'
(R):5'- TTTAATAACCGTTCCCACTGCCCTG -3'

Sequencing Primer
(F):5'- gagaggaagaaacaggcgg -3'
(R):5'- GGCCATCTTCTTCGCCATATTC -3'
Posted On 2013-06-11