Mutagenetix > Incidental Mutation

Incidental Mutation 'R5715:Upf1'

451114

Institutional Source

Beutler Lab

Gene Symbol

Upf1

Ensembl Gene

ENSMUSG00000058301

Gene Name

UPF1 regulator of nonsense transcripts homolog (yeast)

Synonyms

B430202H16Rik, PNORF-1, Rent1

MMRRC Submission

043336-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.970) question?

Stock #

R5715 (G1)

Quality Score

190

Status

Not validated

Chromosome

Chromosomal Location

70331525-70353278 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 70352978 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 6 (Y6N)

Ref Sequence

ENSEMBL: ENSMUSP00000148927 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075666] [ENSMUST00000215817]

AlphaFold

Q9EPU0

Predicted Effect

probably damaging
Transcript: ENSMUST00000075666
AA Change: Y6N

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301
AA Change: Y6N

Domain	Start	End	E-Value	Type
low complexity region	47	67	N/A	INTRINSIC
low complexity region	101	110	N/A	INTRINSIC
Pfam:UPF1_Zn_bind	116	267	4.1e-78	PFAM
Pfam:ResIII	475	617	1.3e-6	PFAM
Pfam:AAA_11	476	600	4.5e-24	PFAM
Pfam:AAA_30	476	688	5.6e-13	PFAM
Pfam:AAA_19	483	559	3.8e-16	PFAM
Pfam:AAA_11	576	679	7.7e-30	PFAM
Pfam:AAA_12	686	883	3.3e-64	PFAM
low complexity region	995	1001	N/A	INTRINSIC
low complexity region	1013	1028	N/A	INTRINSIC
low complexity region	1066	1081	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000215817
AA Change: Y6N

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located only in the cytoplasm. When translation ends, it interacts with the protein that is a functional homolog of yeast Upf2p to trigger mRNA decapping. Use of multiple polyadenylation sites has been noted for this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable in the pre-implantation period but resorb in the early post-implantation period. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931423N10Rik	T	C	2: 23,207,977	Y56H	possibly damaging	Het
9930111J21Rik2	T	A	11: 49,019,950	Y552F	probably damaging	Het
Asprv1	T	A	6: 86,628,614	D147E	probably benign	Het
Atg4c	G	T	4: 99,258,402	L405F	probably damaging	Het
Birc6	C	T	17: 74,631,620	L2670F	probably damaging	Het
Cdc20	T	C	4: 118,434,818	D379G	probably damaging	Het
Chd6	T	C	2: 160,949,878	M2520V	probably benign	Het
Clca4b	A	G	3: 144,913,257	V707A	probably benign	Het
Cmtm1	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	8: 104,309,470		probably benign	Het
Col12a1	A	T	9: 79,616,065	C2743*	probably null	Het
Coq6	C	A	12: 84,366,907	D70E	probably benign	Het
Cspg4	T	A	9: 56,891,051	V1450D	possibly damaging	Het
Dnah7a	A	G	1: 53,413,778	L3847P	probably damaging	Het
Drd2	T	A	9: 49,404,889	H316Q	probably benign	Het
Dusp19	T	A	2: 80,630,986	N206K	probably benign	Het
Fam13c	T	G	10: 70,534,840	F270C	probably damaging	Het
Fam20a	T	C	11: 109,678,431	E246G	probably damaging	Het
Fbxo31	A	G	8: 121,578,563	F65L	probably damaging	Het
Fshr	T	A	17: 88,986,396		probably null	Het
Fstl4	T	C	11: 53,000,416	V127A	possibly damaging	Het
Gdpd4	A	T	7: 97,961,597	I75F	probably benign	Het
Gm13128	A	G	4: 144,331,300	D159G	possibly damaging	Het
Grm5	C	A	7: 88,130,256	A968E	probably benign	Het
Gucy2g	A	C	19: 55,233,155	F305V	possibly damaging	Het
Hivep3	T	C	4: 120,096,373	F629L	probably benign	Het
Hoxb1	A	G	11: 96,366,326	E167G	probably benign	Het
Hoxd4	T	C	2: 74,727,364	L29P	probably damaging	Het
Ikbkb	A	G	8: 22,678,850	L211P	probably damaging	Het
Insc	T	C	7: 114,849,841	V499A	probably benign	Het
Irak3	A	T	10: 120,142,736	H511Q	possibly damaging	Het
Itpripl1	T	C	2: 127,142,007	E65G	probably damaging	Het
Lurap1l	T	A	4: 80,953,721	S150R	possibly damaging	Het
Mab21l3	C	T	3: 101,823,407	R172Q	probably benign	Het
Macf1	T	C	4: 123,684,014	D59G	probably damaging	Het
Mettl21a	A	T	1: 64,615,155	S68T	probably benign	Het
Mlxip	T	A	5: 123,440,058	W146R	probably damaging	Het
Mpp2	T	A	11: 102,062,261	N285I	probably damaging	Het
Mrgprb4	T	C	7: 48,199,039	N47S	probably damaging	Het
Msi2	A	G	11: 88,386,063	Y237H	probably damaging	Het
Muc4	C	T	16: 32,751,916	T598I	possibly damaging	Het
Musk	A	T	4: 58,333,663	I253F	probably damaging	Het
Myo5b	G	T	18: 74,742,175	C1550F	possibly damaging	Het
Nckap5l	T	C	15: 99,423,576	T1137A	probably benign	Het
Neb	T	C	2: 52,251,768	D3009G	probably damaging	Het
Nxph1	T	A	6: 9,247,740	V237E	probably damaging	Het
Olfr622	A	C	7: 103,639,802	S113A	probably damaging	Het
Pla2g12a	A	G	3: 129,894,942	K150E	probably damaging	Het
Ptpn23	G	A	9: 110,387,075	R1238W	probably damaging	Het
Pts	C	T	9: 50,522,278	G124R	probably damaging	Het
Rfk	A	T	19: 17,398,638	I99F	probably benign	Het
Rictor	A	T	15: 6,750,716	R151*	probably null	Het
Scn2a	T	A	2: 65,717,584	I1040N	probably benign	Het
Serinc5	A	C	13: 92,706,202	T387P	probably damaging	Het
Sh3bp5l	A	G	11: 58,346,015	Q266R	possibly damaging	Het
Slc14a2	T	C	18: 78,158,336	Y656C	probably damaging	Het
Slc26a3	T	A	12: 31,448,843		probably null	Het
Slc3a2	G	T	19: 8,708,230	H168Q	probably benign	Het
Smarca2	A	T	19: 26,649,122	I449L	probably benign	Het
Smarcc1	T	C	9: 110,196,367	V704A	possibly damaging	Het
Sox13	A	G	1: 133,386,183		probably null	Het
Sptbn5	T	C	2: 120,072,504	E7G	probably damaging	Het
Stard10	A	G	7: 101,321,903	D26G	probably damaging	Het
Tap1	A	T	17: 34,192,894	R91*	probably null	Het
Tgfbrap1	A	T	1: 43,059,937	V239D	possibly damaging	Het
Tmem209	A	T	6: 30,497,923	Y124*	probably null	Het
Tmprss2	T	A	16: 97,568,983	E327V	possibly damaging	Het
Ttbk1	T	C	17: 46,479,207	Y104C	probably damaging	Het
Ttll10	A	T	4: 156,045,391	F154I	probably damaging	Het
Ubn2	T	A	6: 38,461,477	Y40*	probably null	Het
Ubr5	A	T	15: 38,002,233	S1519T	probably benign	Het
Ugt3a1	A	C	15: 9,306,344	D193A	probably damaging	Het
Vmn2r103	A	T	17: 19,794,939	D447V	probably benign	Het
Vps39	T	C	2: 120,325,236	N519S	possibly damaging	Het
Zfp109	T	C	7: 24,229,570	E138G	possibly damaging	Het
Znrf3	A	C	11: 5,286,239	V157G	possibly damaging	Het

Other mutations in Upf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01113:Upf1	APN	8	70338284	missense	probably benign
IGL01890:Upf1	APN	8	70334230	missense	possibly damaging	0.94
IGL02534:Upf1	APN	8	70335652	critical splice donor site	probably null
IGL03142:Upf1	APN	8	70333327	missense	probably benign	0.04
IGL03151:Upf1	APN	8	70335387	missense	probably damaging	0.98
Nanosphere	UTSW	8	70344262	missense	probably benign	0.01
Particulate	UTSW	8	70337025	missense	probably damaging	0.96
R0270:Upf1	UTSW	8	70335645	splice site	probably benign
R0477:Upf1	UTSW	8	70334080	missense	probably benign
R0755:Upf1	UTSW	8	70334129	missense	probably benign	0.01
R1018:Upf1	UTSW	8	70338906	missense	possibly damaging	0.85
R1067:Upf1	UTSW	8	70338403	missense	probably damaging	0.98
R1445:Upf1	UTSW	8	70341524	missense	probably benign	0.00
R1458:Upf1	UTSW	8	70344254	missense	probably benign	0.00
R1511:Upf1	UTSW	8	70338505	missense	probably damaging	0.99
R1552:Upf1	UTSW	8	70333059	nonsense	probably null
R1560:Upf1	UTSW	8	70338442	missense	probably damaging	1.00
R1562:Upf1	UTSW	8	70343367	nonsense	probably null
R2082:Upf1	UTSW	8	70341572	missense	probably damaging	1.00
R2143:Upf1	UTSW	8	70339354	missense	probably null	1.00
R2423:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R2425:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3031:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3032:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3123:Upf1	UTSW	8	70337483	splice site	probably benign
R3508:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3747:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3748:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3750:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3754:Upf1	UTSW	8	70339814	missense	probably benign	0.30
R3964:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3965:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4152:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4505:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4506:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4838:Upf1	UTSW	8	70339368	missense	probably benign	0.03
R5001:Upf1	UTSW	8	70334700	missense	probably damaging	1.00
R5748:Upf1	UTSW	8	70338517	missense	probably damaging	1.00
R5856:Upf1	UTSW	8	70334762	critical splice acceptor site	probably null
R5930:Upf1	UTSW	8	70344262	missense	probably benign	0.01
R6010:Upf1	UTSW	8	70337025	missense	probably damaging	0.96
R6056:Upf1	UTSW	8	70333037	missense	probably damaging	0.98
R6870:Upf1	UTSW	8	70341561	missense	probably benign	0.11
R7205:Upf1	UTSW	8	70340045	missense	possibly damaging	0.94
R7385:Upf1	UTSW	8	70340618	missense	probably damaging	1.00
R7464:Upf1	UTSW	8	70333423	missense	probably benign
R7759:Upf1	UTSW	8	70334080	missense	probably benign
R7783:Upf1	UTSW	8	70352858	missense	probably benign	0.11
R8079:Upf1	UTSW	8	70338884	critical splice donor site	probably null
R8192:Upf1	UTSW	8	70340644	missense	probably benign	0.03
R8544:Upf1	UTSW	8	70337052	missense	probably damaging	1.00
R8738:Upf1	UTSW	8	70333322	missense	probably benign	0.01
R8738:Upf1	UTSW	8	70333323	missense	probably benign	0.06
R8826:Upf1	UTSW	8	70338280	missense	probably benign
R8876:Upf1	UTSW	8	70344268	missense	possibly damaging	0.92
R8906:Upf1	UTSW	8	70334165	nonsense	probably null
R8911:Upf1	UTSW	8	70338437	missense	possibly damaging	0.53
R9163:Upf1	UTSW	8	70340024	missense	probably benign
R9425:Upf1	UTSW	8	70339353	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- GGCTGGTTAACTGGGATCTAGC -3'
(R):5'- AACTCAGAGCTCAGAACCGG -3'

Sequencing Primer
(F):5'- AACTCACTTGTGCGTCGAG -3'
(R):5'- CTCAGAACCGGCGGCCC -3'

Posted On

2017-01-03