Incidental Mutation 'R5715:Fbxo31'
ID451116
Institutional Source Beutler Lab
Gene Symbol Fbxo31
Ensembl Gene ENSMUSG00000052934
Gene NameF-box protein 31
Synonyms1110003O08Rik, Fbx14, Fbxo14, 2310046N15Rik
MMRRC Submission 043336-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5715 (G1)
Quality Score118
Status Not validated
Chromosome8
Chromosomal Location121549440-121578806 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121578563 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 65 (F65L)
Ref Sequence ENSEMBL: ENSMUSP00000057573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059018] [ENSMUST00000127664]
Predicted Effect probably damaging
Transcript: ENSMUST00000059018
AA Change: F65L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057573
Gene: ENSMUSG00000052934
AA Change: F65L

DomainStartEndE-ValueType
low complexity region 14 24 N/A INTRINSIC
low complexity region 25 42 N/A INTRINSIC
FBOX 56 96 3.45e-8 SMART
low complexity region 358 379 N/A INTRINSIC
low complexity region 385 412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181663
SMART Domains Protein: ENSMUSP00000137907
Gene: ENSMUSG00000052934

DomainStartEndE-ValueType
low complexity region 14 24 N/A INTRINSIC
low complexity region 25 42 N/A INTRINSIC
FBOX 56 96 3.45e-8 SMART
transmembrane domain 156 178 N/A INTRINSIC
low complexity region 190 201 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182000
Predicted Effect unknown
Transcript: ENSMUST00000212985
AA Change: F62L
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the F-box family. Members are classified into three classes according to the substrate interaction domain, FBW for WD40 repeats, FBL for leucing-rich repeats, and FBXO for other domains. This protein, classified into the last category because of the lack of a recognizable substrate binding domain, has been proposed to be a component of the SCF ubiquitination complex. It is thought to bind and recruit substrate for ubiquitination and degradation. This protein may have a role in regulating the cell cycle as well as dendrite growth and neuronal migration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T C 2: 23,207,977 Y56H possibly damaging Het
9930111J21Rik2 T A 11: 49,019,950 Y552F probably damaging Het
Asprv1 T A 6: 86,628,614 D147E probably benign Het
Atg4c G T 4: 99,258,402 L405F probably damaging Het
Birc6 C T 17: 74,631,620 L2670F probably damaging Het
Cdc20 T C 4: 118,434,818 D379G probably damaging Het
Chd6 T C 2: 160,949,878 M2520V probably benign Het
Clca4b A G 3: 144,913,257 V707A probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Col12a1 A T 9: 79,616,065 C2743* probably null Het
Coq6 C A 12: 84,366,907 D70E probably benign Het
Cspg4 T A 9: 56,891,051 V1450D possibly damaging Het
Dnah7a A G 1: 53,413,778 L3847P probably damaging Het
Drd2 T A 9: 49,404,889 H316Q probably benign Het
Dusp19 T A 2: 80,630,986 N206K probably benign Het
Fam13c T G 10: 70,534,840 F270C probably damaging Het
Fam20a T C 11: 109,678,431 E246G probably damaging Het
Fshr T A 17: 88,986,396 probably null Het
Fstl4 T C 11: 53,000,416 V127A possibly damaging Het
Gdpd4 A T 7: 97,961,597 I75F probably benign Het
Gm13128 A G 4: 144,331,300 D159G possibly damaging Het
Grm5 C A 7: 88,130,256 A968E probably benign Het
Gucy2g A C 19: 55,233,155 F305V possibly damaging Het
Hivep3 T C 4: 120,096,373 F629L probably benign Het
Hoxb1 A G 11: 96,366,326 E167G probably benign Het
Hoxd4 T C 2: 74,727,364 L29P probably damaging Het
Ikbkb A G 8: 22,678,850 L211P probably damaging Het
Insc T C 7: 114,849,841 V499A probably benign Het
Irak3 A T 10: 120,142,736 H511Q possibly damaging Het
Itpripl1 T C 2: 127,142,007 E65G probably damaging Het
Lurap1l T A 4: 80,953,721 S150R possibly damaging Het
Mab21l3 C T 3: 101,823,407 R172Q probably benign Het
Macf1 T C 4: 123,684,014 D59G probably damaging Het
Mettl21a A T 1: 64,615,155 S68T probably benign Het
Mlxip T A 5: 123,440,058 W146R probably damaging Het
Mpp2 T A 11: 102,062,261 N285I probably damaging Het
Mrgprb4 T C 7: 48,199,039 N47S probably damaging Het
Msi2 A G 11: 88,386,063 Y237H probably damaging Het
Muc4 C T 16: 32,751,916 T598I possibly damaging Het
Musk A T 4: 58,333,663 I253F probably damaging Het
Myo5b G T 18: 74,742,175 C1550F possibly damaging Het
Nckap5l T C 15: 99,423,576 T1137A probably benign Het
Neb T C 2: 52,251,768 D3009G probably damaging Het
Nxph1 T A 6: 9,247,740 V237E probably damaging Het
Olfr622 A C 7: 103,639,802 S113A probably damaging Het
Pla2g12a A G 3: 129,894,942 K150E probably damaging Het
Ptpn23 G A 9: 110,387,075 R1238W probably damaging Het
Pts C T 9: 50,522,278 G124R probably damaging Het
Rfk A T 19: 17,398,638 I99F probably benign Het
Rictor A T 15: 6,750,716 R151* probably null Het
Scn2a T A 2: 65,717,584 I1040N probably benign Het
Serinc5 A C 13: 92,706,202 T387P probably damaging Het
Sh3bp5l A G 11: 58,346,015 Q266R possibly damaging Het
Slc14a2 T C 18: 78,158,336 Y656C probably damaging Het
Slc26a3 T A 12: 31,448,843 probably null Het
Slc3a2 G T 19: 8,708,230 H168Q probably benign Het
Smarca2 A T 19: 26,649,122 I449L probably benign Het
Smarcc1 T C 9: 110,196,367 V704A possibly damaging Het
Sox13 A G 1: 133,386,183 probably null Het
Sptbn5 T C 2: 120,072,504 E7G probably damaging Het
Stard10 A G 7: 101,321,903 D26G probably damaging Het
Tap1 A T 17: 34,192,894 R91* probably null Het
Tgfbrap1 A T 1: 43,059,937 V239D possibly damaging Het
Tmem209 A T 6: 30,497,923 Y124* probably null Het
Tmprss2 T A 16: 97,568,983 E327V possibly damaging Het
Ttbk1 T C 17: 46,479,207 Y104C probably damaging Het
Ttll10 A T 4: 156,045,391 F154I probably damaging Het
Ubn2 T A 6: 38,461,477 Y40* probably null Het
Ubr5 A T 15: 38,002,233 S1519T probably benign Het
Ugt3a1 A C 15: 9,306,344 D193A probably damaging Het
Upf1 A T 8: 70,352,978 Y6N probably damaging Het
Vmn2r103 A T 17: 19,794,939 D447V probably benign Het
Vps39 T C 2: 120,325,236 N519S possibly damaging Het
Zfp109 T C 7: 24,229,570 E138G possibly damaging Het
Znrf3 A C 11: 5,286,239 V157G possibly damaging Het
Other mutations in Fbxo31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Fbxo31 APN 8 121554330 missense possibly damaging 0.92
IGL02155:Fbxo31 APN 8 121559075 missense probably damaging 1.00
IGL02551:Fbxo31 APN 8 121566344 missense probably damaging 0.99
IGL03092:Fbxo31 APN 8 121560018 missense probably benign
R0377:Fbxo31 UTSW 8 121559102 unclassified probably benign
R0730:Fbxo31 UTSW 8 121555364 unclassified probably benign
R1132:Fbxo31 UTSW 8 121552276 frame shift probably null
R1132:Fbxo31 UTSW 8 121552280 frame shift probably null
R1626:Fbxo31 UTSW 8 121560006 missense probably damaging 1.00
R1796:Fbxo31 UTSW 8 121560438 nonsense probably null
R2215:Fbxo31 UTSW 8 121566311 missense probably benign 0.01
R3726:Fbxo31 UTSW 8 121578509 missense probably damaging 1.00
R3761:Fbxo31 UTSW 8 121560430 missense possibly damaging 0.94
R4646:Fbxo31 UTSW 8 121560016 missense probably benign
R4782:Fbxo31 UTSW 8 121552439 nonsense probably null
R4782:Fbxo31 UTSW 8 121552441 missense probably damaging 1.00
R5103:Fbxo31 UTSW 8 121552362 missense probably damaging 1.00
R6347:Fbxo31 UTSW 8 121578459 missense possibly damaging 0.69
R6551:Fbxo31 UTSW 8 121564704 intron probably benign
R7027:Fbxo31 UTSW 8 121578485 missense probably damaging 1.00
R7156:Fbxo31 UTSW 8 121554321 missense possibly damaging 0.83
R7271:Fbxo31 UTSW 8 121578764 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CATTATTCCTGCACCGGGAG -3'
(R):5'- CATACAAGGGCGTGGACCTAAC -3'

Sequencing Primer
(F):5'- AGCAGGCCTGGTTTGGAACTC -3'
(R):5'- TTGAGGAGCCTGCAAGC -3'
Posted On2017-01-03