Incidental Mutation 'R5716:Nuf2'
ID451155
Institutional Source Beutler Lab
Gene Symbol Nuf2
Ensembl Gene ENSMUSG00000026683
Gene NameNUF2, NDC80 kinetochore complex component
SynonymsNuf2R, Cdca1, 2410003C07Rik
MMRRC Submission 043187-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.940) question?
Stock #R5716 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location169497934-169531464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 169522389 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 107 (V107F)
Ref Sequence ENSEMBL: ENSMUSP00000141427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028000] [ENSMUST00000111368] [ENSMUST00000192248]
Predicted Effect probably benign
Transcript: ENSMUST00000028000
AA Change: V107F

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000028000
Gene: ENSMUSG00000026683
AA Change: V107F

DomainStartEndE-ValueType
Pfam:Nuf2 1 149 9.7e-46 PFAM
coiled coil region 174 227 N/A INTRINSIC
coiled coil region 290 343 N/A INTRINSIC
coiled coil region 389 462 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111368
AA Change: V107F

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106999
Gene: ENSMUSG00000026683
AA Change: V107F

DomainStartEndE-ValueType
Pfam:Nuf2 3 146 6.5e-37 PFAM
coiled coil region 174 227 N/A INTRINSIC
coiled coil region 290 343 N/A INTRINSIC
coiled coil region 389 462 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192248
AA Change: V107F

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141427
Gene: ENSMUSG00000026683
AA Change: V107F

DomainStartEndE-ValueType
Pfam:Nuf2 1 149 2.3e-43 PFAM
SCOP:d1ab4__ 154 210 9e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194831
Predicted Effect probably benign
Transcript: ENSMUST00000195342
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is highly similar to yeast Nuf2, a component of a conserved protein complex associated with the centromere. Yeast Nuf2 disappears from the centromere during meiotic prophase when centromeres lose their connection to the spindle pole body, and plays a regulatory role in chromosome segregation. The encoded protein is found to be associated with centromeres of mitotic HeLa cells, which suggests that this protein is a functional homolog of yeast Nuf2. Alternatively spliced transcript variants that encode the same protein have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T C 11: 58,421,768 V24A possibly damaging Het
Abca14 G A 7: 120,246,994 probably null Het
Acad12 A G 5: 121,609,983 V124A probably benign Het
Alg1 A T 16: 5,239,956 D238V probably damaging Het
Bcar3 A G 3: 122,512,915 E179G probably damaging Het
Brf2 A G 8: 27,126,046 S104P probably benign Het
Coq8a A T 1: 180,179,260 Y21N possibly damaging Het
Cramp1l A G 17: 24,974,735 F924L probably damaging Het
Dpyd G T 3: 118,899,179 C324F probably damaging Het
Eif4b T C 15: 102,082,059 Y33H probably benign Het
Fry C T 5: 150,370,221 Q460* probably null Het
Fryl T C 5: 73,100,465 I665V probably benign Het
Gm9573 A C 17: 35,620,783 probably benign Het
Gpank1 A G 17: 35,123,253 K90E probably damaging Het
Hexdc A G 11: 121,221,562 I482V probably benign Het
Hmcn2 G A 2: 31,336,567 E185K probably damaging Het
Hmcn2 A G 2: 31,458,738 E4922G possibly damaging Het
Ino80d A T 1: 63,058,697 D679E probably benign Het
Kalrn A T 16: 33,987,176 C2608S probably benign Het
Kars T A 8: 112,003,442 probably null Het
Lcn2 A G 2: 32,385,813 V211A possibly damaging Het
Lsmem1 A T 12: 40,180,693 V70E possibly damaging Het
Med12l T C 3: 59,301,377 probably null Het
Megf11 T C 9: 64,506,110 F60L possibly damaging Het
Neb T A 2: 52,210,584 H4438L probably benign Het
Olfr127 A T 17: 37,903,828 Y94F probably benign Het
Olfr1501 C T 19: 13,838,639 C178Y probably damaging Het
Olfr767 T A 10: 129,079,555 N136I probably benign Het
Pabpn1l A G 8: 122,620,421 V215A probably damaging Het
Pnn A G 12: 59,071,872 I414V probably benign Het
Rab11fip3 A G 17: 26,036,664 Y539H probably damaging Het
Rassf4 A G 6: 116,661,867 V13A probably benign Het
Sephs1 T C 2: 4,884,578 F56L probably benign Het
Sh3rf3 C T 10: 59,131,283 P816S probably benign Het
Skint10 A G 4: 112,711,647 L291P probably damaging Het
Thsd7a T A 6: 12,343,148 I1157L probably benign Het
Tmem184c T C 8: 77,606,407 H85R possibly damaging Het
Tmem94 T C 11: 115,792,428 V679A probably benign Het
Tpcn2 A C 7: 145,257,813 F566V possibly damaging Het
Uqcrc1 A G 9: 108,947,405 N298D probably benign Het
Other mutations in Nuf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00707:Nuf2 APN 1 169522435 unclassified probably benign
IGL00980:Nuf2 APN 1 169510434 missense probably damaging 1.00
IGL01131:Nuf2 APN 1 169522364 splice site probably benign
IGL01310:Nuf2 APN 1 169498862 missense probably benign 0.12
IGL01774:Nuf2 APN 1 169506072 missense probably benign
IGL01786:Nuf2 APN 1 169510483 missense possibly damaging 0.88
IGL01866:Nuf2 APN 1 169498838 missense possibly damaging 0.68
IGL02134:Nuf2 APN 1 169513500 missense probably benign
IGL02955:Nuf2 APN 1 169507238 splice site probably benign
R0350:Nuf2 UTSW 1 169513543 critical splice acceptor site probably null
R0390:Nuf2 UTSW 1 169525297 unclassified probably benign
R0479:Nuf2 UTSW 1 169498934 splice site probably benign
R0578:Nuf2 UTSW 1 169510549 splice site probably benign
R0765:Nuf2 UTSW 1 169522936 unclassified probably benign
R1351:Nuf2 UTSW 1 169510549 splice site probably benign
R1564:Nuf2 UTSW 1 169498793 missense unknown
R3747:Nuf2 UTSW 1 169525376 missense probably damaging 1.00
R3748:Nuf2 UTSW 1 169525376 missense probably damaging 1.00
R3749:Nuf2 UTSW 1 169525376 missense probably damaging 1.00
R4601:Nuf2 UTSW 1 169506114 missense probably damaging 1.00
R4815:Nuf2 UTSW 1 169510468 missense probably damaging 1.00
R5473:Nuf2 UTSW 1 169507287 missense probably benign 0.05
R5522:Nuf2 UTSW 1 169498884 missense probably damaging 1.00
R5742:Nuf2 UTSW 1 169516622 missense probably damaging 1.00
R6583:Nuf2 UTSW 1 169504548 missense probably benign
R6680:Nuf2 UTSW 1 169515009 intron probably null
R7068:Nuf2 UTSW 1 169522419 missense probably damaging 1.00
R7099:Nuf2 UTSW 1 169506072 missense probably benign
R7186:Nuf2 UTSW 1 169525385 missense probably damaging 0.99
R7527:Nuf2 UTSW 1 169498853 missense possibly damaging 0.55
R7578:Nuf2 UTSW 1 169504528 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCATATACTGCGTCCCTTAGTG -3'
(R):5'- CAGATTTGAGCACTGCAGGAC -3'

Sequencing Primer
(F):5'- GTGCTTGCCACATTTCCTAGACAAAG -3'
(R):5'- AGGACTGCACTGCCGTAG -3'
Posted On2017-01-03