Incidental Mutation 'R5716:Bcar3'
ID451168
Institutional Source Beutler Lab
Gene Symbol Bcar3
Ensembl Gene ENSMUSG00000028121
Gene Namebreast cancer anti-estrogen resistance 3
SynonymsAND-34
MMRRC Submission 043187-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.741) question?
Stock #R5716 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location122294136-122530191 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122512915 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 179 (E179G)
Ref Sequence ENSEMBL: ENSMUSP00000143711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029766] [ENSMUST00000197073] [ENSMUST00000198659] [ENSMUST00000199344] [ENSMUST00000199358]
Predicted Effect probably damaging
Transcript: ENSMUST00000029766
AA Change: E528G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000029766
Gene: ENSMUSG00000028121
AA Change: E528G

DomainStartEndE-ValueType
low complexity region 126 145 N/A INTRINSIC
SH2 146 234 3.17e-21 SMART
low complexity region 395 406 N/A INTRINSIC
RasGEF 539 814 2.55e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197073
SMART Domains Protein: ENSMUSP00000142469
Gene: ENSMUSG00000028121

DomainStartEndE-ValueType
low complexity region 41 60 N/A INTRINSIC
SH2 61 149 2e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197956
Predicted Effect probably damaging
Transcript: ENSMUST00000198659
AA Change: E179G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143112
Gene: ENSMUSG00000028121
AA Change: E179G

DomainStartEndE-ValueType
low complexity region 46 57 N/A INTRINSIC
PDB:3T6A|D 149 186 4e-13 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000199344
AA Change: E179G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143711
Gene: ENSMUSG00000028121
AA Change: E179G

DomainStartEndE-ValueType
low complexity region 46 57 N/A INTRINSIC
PDB:3T6A|D 149 261 3e-61 PDB
SCOP:d1bkds_ 168 260 1e-7 SMART
Blast:RasGEF 190 261 2e-42 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199358
SMART Domains Protein: ENSMUSP00000142340
Gene: ENSMUSG00000028121

DomainStartEndE-ValueType
low complexity region 6 25 N/A INTRINSIC
SH2 26 114 2e-23 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Breast tumors are initially dependent on estrogens for growth and progression and can be inhibited by anti-estrogens such as tamoxifen. However, breast cancers progress to become anti-estrogen resistant. Breast cancer anti-estrogen resistance gene 3 was identified in the search for genes involved in the development of estrogen resistance. The gene encodes a component of intracellular signal transduction that causes estrogen-independent proliferation in human breast cancer cells. The protein contains a putative src homology 2 (SH2) domain, a hall mark of cellular tyrosine kinase signaling molecules, and is partly homologous to the cell division cycle protein CDC48. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit cataracts due to rupture of the lens capsule and liquefaction of lens cortical fibers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T C 11: 58,421,768 V24A possibly damaging Het
Abca14 G A 7: 120,246,994 probably null Het
Acad12 A G 5: 121,609,983 V124A probably benign Het
Alg1 A T 16: 5,239,956 D238V probably damaging Het
Brf2 A G 8: 27,126,046 S104P probably benign Het
Coq8a A T 1: 180,179,260 Y21N possibly damaging Het
Cramp1l A G 17: 24,974,735 F924L probably damaging Het
Dpyd G T 3: 118,899,179 C324F probably damaging Het
Eif4b T C 15: 102,082,059 Y33H probably benign Het
Fry C T 5: 150,370,221 Q460* probably null Het
Fryl T C 5: 73,100,465 I665V probably benign Het
Gm9573 A C 17: 35,620,783 probably benign Het
Gpank1 A G 17: 35,123,253 K90E probably damaging Het
Hexdc A G 11: 121,221,562 I482V probably benign Het
Hmcn2 G A 2: 31,336,567 E185K probably damaging Het
Hmcn2 A G 2: 31,458,738 E4922G possibly damaging Het
Ino80d A T 1: 63,058,697 D679E probably benign Het
Kalrn A T 16: 33,987,176 C2608S probably benign Het
Kars T A 8: 112,003,442 probably null Het
Lcn2 A G 2: 32,385,813 V211A possibly damaging Het
Lsmem1 A T 12: 40,180,693 V70E possibly damaging Het
Med12l T C 3: 59,301,377 probably null Het
Megf11 T C 9: 64,506,110 F60L possibly damaging Het
Neb T A 2: 52,210,584 H4438L probably benign Het
Nuf2 C A 1: 169,522,389 V107F probably benign Het
Olfr127 A T 17: 37,903,828 Y94F probably benign Het
Olfr1501 C T 19: 13,838,639 C178Y probably damaging Het
Olfr767 T A 10: 129,079,555 N136I probably benign Het
Pabpn1l A G 8: 122,620,421 V215A probably damaging Het
Pnn A G 12: 59,071,872 I414V probably benign Het
Rab11fip3 A G 17: 26,036,664 Y539H probably damaging Het
Rassf4 A G 6: 116,661,867 V13A probably benign Het
Sephs1 T C 2: 4,884,578 F56L probably benign Het
Sh3rf3 C T 10: 59,131,283 P816S probably benign Het
Skint10 A G 4: 112,711,647 L291P probably damaging Het
Thsd7a T A 6: 12,343,148 I1157L probably benign Het
Tmem184c T C 8: 77,606,407 H85R possibly damaging Het
Tmem94 T C 11: 115,792,428 V679A probably benign Het
Tpcn2 A C 7: 145,257,813 F566V possibly damaging Het
Uqcrc1 A G 9: 108,947,405 N298D probably benign Het
Other mutations in Bcar3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Bcar3 APN 3 122512936 missense probably benign 0.36
IGL01372:Bcar3 APN 3 122523294 missense probably damaging 1.00
IGL02681:Bcar3 APN 3 122512768 unclassified probably null
IGL03403:Bcar3 APN 3 122512969 missense probably benign 0.01
R0408:Bcar3 UTSW 3 122508384 missense probably damaging 0.98
R0531:Bcar3 UTSW 3 122426499 missense probably benign 0.00
R0798:Bcar3 UTSW 3 122525299 missense probably benign 0.01
R1445:Bcar3 UTSW 3 122523191 missense probably damaging 0.98
R1892:Bcar3 UTSW 3 122508136 missense probably benign 0.00
R2138:Bcar3 UTSW 3 122512996 missense probably damaging 1.00
R3236:Bcar3 UTSW 3 122524996 missense probably benign 0.02
R3237:Bcar3 UTSW 3 122524996 missense probably benign 0.02
R3832:Bcar3 UTSW 3 122426649 missense probably damaging 1.00
R4801:Bcar3 UTSW 3 122529594 missense probably benign 0.22
R4802:Bcar3 UTSW 3 122529594 missense probably benign 0.22
R5342:Bcar3 UTSW 3 122426649 missense probably damaging 1.00
R5364:Bcar3 UTSW 3 122529632 missense probably benign 0.41
R5560:Bcar3 UTSW 3 122426575 missense possibly damaging 0.92
R5714:Bcar3 UTSW 3 122455087 missense possibly damaging 0.88
R5944:Bcar3 UTSW 3 122523283 missense probably benign
R6478:Bcar3 UTSW 3 122426576 missense probably benign 0.04
R6615:Bcar3 UTSW 3 122426633 missense probably benign 0.00
R6996:Bcar3 UTSW 3 122508384 missense possibly damaging 0.95
R7272:Bcar3 UTSW 3 122508396 missense possibly damaging 0.92
R7308:Bcar3 UTSW 3 122508493 missense probably benign 0.00
R7353:Bcar3 UTSW 3 122512692 missense probably benign 0.00
R7465:Bcar3 UTSW 3 122523230 missense probably benign 0.13
R7816:Bcar3 UTSW 3 122426694 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGGAACTCTGGCATCAACTAC -3'
(R):5'- CACACCTGCGTTACTGTCTG -3'

Sequencing Primer
(F):5'- CAACTACATGATCCTTGATGGGG -3'
(R):5'- GGCTTTCTCCCCTATGACGAAG -3'
Posted On2017-01-03