Mutagenetix > Incidental Mutations

Incidental Mutation 'R5716:Bcar3'

451168

Institutional Source

Beutler Lab

Gene Symbol

Bcar3

Ensembl Gene

ENSMUSG00000028121

Gene Name

breast cancer anti-estrogen resistance 3

Synonyms

AND-34

MMRRC Submission

043187-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.741) question?

Stock #

R5716 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

122294136-122530191 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 122512915 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 179 (E179G)

Ref Sequence

ENSEMBL: ENSMUSP00000143711 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029766] [ENSMUST00000197073] [ENSMUST00000198659] [ENSMUST00000199344] [ENSMUST00000199358]

Predicted Effect

probably damaging
Transcript: ENSMUST00000029766
AA Change: E528G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000029766
Gene: ENSMUSG00000028121
AA Change: E528G

Domain	Start	End	E-Value	Type
low complexity region	126	145	N/A	INTRINSIC
SH2	146	234	3.17e-21	SMART
low complexity region	395	406	N/A	INTRINSIC
RasGEF	539	814	2.55e-52	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000197073

SMART Domains

Protein: ENSMUSP00000142469
Gene: ENSMUSG00000028121

Domain	Start	End	E-Value	Type
low complexity region	41	60	N/A	INTRINSIC
SH2	61	149	2e-23	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197956

Predicted Effect

probably damaging
Transcript: ENSMUST00000198659
AA Change: E179G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000143112
Gene: ENSMUSG00000028121
AA Change: E179G

Domain	Start	End	E-Value	Type
low complexity region	46	57	N/A	INTRINSIC
PDB:3T6A\|D	149	186	4e-13	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000199344
AA Change: E179G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000143711
Gene: ENSMUSG00000028121
AA Change: E179G

Domain	Start	End	E-Value	Type
low complexity region	46	57	N/A	INTRINSIC
PDB:3T6A\|D	149	261	3e-61	PDB
SCOP:d1bkds_	168	260	1e-7	SMART
Blast:RasGEF	190	261	2e-42	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000199358

SMART Domains

Protein: ENSMUSP00000142340
Gene: ENSMUSG00000028121

Domain	Start	End	E-Value	Type
low complexity region	6	25	N/A	INTRINSIC
SH2	26	114	2e-23	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Breast tumors are initially dependent on estrogens for growth and progression and can be inhibited by anti-estrogens such as tamoxifen. However, breast cancers progress to become anti-estrogen resistant. Breast cancer anti-estrogen resistance gene 3 was identified in the search for genes involved in the development of estrogen resistance. The gene encodes a component of intracellular signal transduction that causes estrogen-independent proliferation in human breast cancer cells. The protein contains a putative src homology 2 (SH2) domain, a hall mark of cellular tyrosine kinase signaling molecules, and is partly homologous to the cell division cycle protein CDC48. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit cataracts due to rupture of the lens capsule and liquefaction of lens cortical fibers. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810065E05Rik	T	C	11: 58,421,768	V24A	possibly damaging	Het
Abca14	G	A	7: 120,246,994		probably null	Het
Acad12	A	G	5: 121,609,983	V124A	probably benign	Het
Alg1	A	T	16: 5,239,956	D238V	probably damaging	Het
Brf2	A	G	8: 27,126,046	S104P	probably benign	Het
Coq8a	A	T	1: 180,179,260	Y21N	possibly damaging	Het
Cramp1l	A	G	17: 24,974,735	F924L	probably damaging	Het
Dpyd	G	T	3: 118,899,179	C324F	probably damaging	Het
Eif4b	T	C	15: 102,082,059	Y33H	probably benign	Het
Fry	C	T	5: 150,370,221	Q460*	probably null	Het
Fryl	T	C	5: 73,100,465	I665V	probably benign	Het
Gm9573	A	C	17: 35,620,783		probably benign	Het
Gpank1	A	G	17: 35,123,253	K90E	probably damaging	Het
Hexdc	A	G	11: 121,221,562	I482V	probably benign	Het
Hmcn2	G	A	2: 31,336,567	E185K	probably damaging	Het
Hmcn2	A	G	2: 31,458,738	E4922G	possibly damaging	Het
Ino80d	A	T	1: 63,058,697	D679E	probably benign	Het
Kalrn	A	T	16: 33,987,176	C2608S	probably benign	Het
Kars	T	A	8: 112,003,442		probably null	Het
Lcn2	A	G	2: 32,385,813	V211A	possibly damaging	Het
Lsmem1	A	T	12: 40,180,693	V70E	possibly damaging	Het
Med12l	T	C	3: 59,301,377		probably null	Het
Megf11	T	C	9: 64,506,110	F60L	possibly damaging	Het
Neb	T	A	2: 52,210,584	H4438L	probably benign	Het
Nuf2	C	A	1: 169,522,389	V107F	probably benign	Het
Olfr127	A	T	17: 37,903,828	Y94F	probably benign	Het
Olfr1501	C	T	19: 13,838,639	C178Y	probably damaging	Het
Olfr767	T	A	10: 129,079,555	N136I	probably benign	Het
Pabpn1l	A	G	8: 122,620,421	V215A	probably damaging	Het
Pnn	A	G	12: 59,071,872	I414V	probably benign	Het
Rab11fip3	A	G	17: 26,036,664	Y539H	probably damaging	Het
Rassf4	A	G	6: 116,661,867	V13A	probably benign	Het
Sephs1	T	C	2: 4,884,578	F56L	probably benign	Het
Sh3rf3	C	T	10: 59,131,283	P816S	probably benign	Het
Skint10	A	G	4: 112,711,647	L291P	probably damaging	Het
Thsd7a	T	A	6: 12,343,148	I1157L	probably benign	Het
Tmem184c	T	C	8: 77,606,407	H85R	possibly damaging	Het
Tmem94	T	C	11: 115,792,428	V679A	probably benign	Het
Tpcn2	A	C	7: 145,257,813	F566V	possibly damaging	Het
Uqcrc1	A	G	9: 108,947,405	N298D	probably benign	Het

Other mutations in Bcar3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00662:Bcar3	APN	3	122512936	missense	probably benign	0.36
IGL01372:Bcar3	APN	3	122523294	missense	probably damaging	1.00
IGL02681:Bcar3	APN	3	122512768	unclassified	probably null
IGL03403:Bcar3	APN	3	122512969	missense	probably benign	0.01
R0408:Bcar3	UTSW	3	122508384	missense	probably damaging	0.98
R0531:Bcar3	UTSW	3	122426499	missense	probably benign	0.00
R0798:Bcar3	UTSW	3	122525299	missense	probably benign	0.01
R1445:Bcar3	UTSW	3	122523191	missense	probably damaging	0.98
R1892:Bcar3	UTSW	3	122508136	missense	probably benign	0.00
R2138:Bcar3	UTSW	3	122512996	missense	probably damaging	1.00
R3236:Bcar3	UTSW	3	122524996	missense	probably benign	0.02
R3237:Bcar3	UTSW	3	122524996	missense	probably benign	0.02
R3832:Bcar3	UTSW	3	122426649	missense	probably damaging	1.00
R4801:Bcar3	UTSW	3	122529594	missense	probably benign	0.22
R4802:Bcar3	UTSW	3	122529594	missense	probably benign	0.22
R5342:Bcar3	UTSW	3	122426649	missense	probably damaging	1.00
R5364:Bcar3	UTSW	3	122529632	missense	probably benign	0.41
R5560:Bcar3	UTSW	3	122426575	missense	possibly damaging	0.92
R5714:Bcar3	UTSW	3	122455087	missense	possibly damaging	0.88
R5944:Bcar3	UTSW	3	122523283	missense	probably benign
R6478:Bcar3	UTSW	3	122426576	missense	probably benign	0.04
R6615:Bcar3	UTSW	3	122426633	missense	probably benign	0.00
R6996:Bcar3	UTSW	3	122508384	missense	possibly damaging	0.95
R7272:Bcar3	UTSW	3	122508396	missense	possibly damaging	0.92
R7308:Bcar3	UTSW	3	122508493	missense	probably benign	0.00
R7353:Bcar3	UTSW	3	122512692	missense	probably benign	0.00
R7465:Bcar3	UTSW	3	122523230	missense	probably benign	0.13
R7816:Bcar3	UTSW	3	122426694	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CGGAACTCTGGCATCAACTAC -3'
(R):5'- CACACCTGCGTTACTGTCTG -3'

Sequencing Primer
(F):5'- CAACTACATGATCCTTGATGGGG -3'
(R):5'- GGCTTTCTCCCCTATGACGAAG -3'

Posted On

2017-01-03